Joł, joł, joł!!! I co a nie mówiłem, czyli pisałem?!! Piję tu do tego, co napisałem Robertowi, o tym, że nad tymi danymi zapadnie dumna i błogosławiona cisza… Łatwowiernym ludkom wydaje się, że jak odbezpieczony granat wpadł w szambo, to nie wybuchnie, bo go gówno zakręconych pomówień zalepi, jak zalepia usta, uszy i mózgi, tym, którzy w tym szambie pływają, jak ryby w mętnej wodzie… To se ne wrati pane Majdanek… Granat, albo raczej ich wiązka nieubłaganie wybuchnie jeden po drugim, a to co do tej pory usłyszeliście, to był TYLKO JEGO PLUSK… 🙂
Z dobrego serca radzę… czytać źródła… myśleć samodzielnie i błagać o zmiłowanie… Z tym zmiłowaniem to żartowałem…
Jeśli kogoś coś ochlapało, no to pomyślcie co upowszechnię pod koniec tygodnia… Na razie też dumnie będę siedział cicho… aczkolwiek… powrzucam trochę kamyków, popuszczam sobie trochę bączków… jak ten poniżej…
Zakładam, że i z tych danych też wolne umysły niewiele zrozumio, no ale znajcie pańską łaskę, bo co nieco podpowiem… Spójrzcie jakie R1a jest odkryte i gdzie, itd,.. Ma to związek z powstaniem języków bałtyjskich…
Czy ktoś rozumie już,.. CZEGO TAM NIE MA?!! 🙂
Kurcze!!! Ludzie to jest kolejny materiał na obrazoburczy wpis!!! Upowszechniam tu nie tylko to, co dotyczy północy i Bałtów, bo także to, co dotyczy Scytów, jak i dwóch różnych zestawów mtDNA odnajdywanych w Europie!!!
https://yhrd.org/tools/branch/R1a-Z645
Łapacze ruskich trolli, czy innych szpionów Putina, wiecie już, że macie przechlapane? Myślę, że Świadomość Nieskończona „trochę” sobie z was i waszych mondrości zażartowała… 🙂 LOL 🙂
Ludzie… to KONIEC bredzeń o „starożytności” języka litweskiego i innych bałtyjskich… Tak, tak Sławomirze… Za prawdę powiadam Ci, poszukuj podkładu językowego w j. polskim… 🙂
Po ….. zamieszczam resztę ciekawostek o Scytach, Afanasiewo, Andronowo i Sintashta… hehehe
http://eurogenes.blogspot.co.uk/2017/03/the-genetic-history-of-northern-europe.html
Friday, March 3, 2017
The genetic history of Northern Europe (or rather the South Baltic)
A second preprint in only a few days on the Neolithic transition in the Baltic region has just appeared at bioRxiv: Mittnik et al. 2017. You can read about the first one here. Keep in mind also that we recently saw a paper on the same topic at Current Biology.
Can’t these labs coordinate things a little better and perhaps focus on different parts of Europe? Wouldn’t that be the sensible thing to do considering the limited funding for ancient DNA research?
Nevertheless, Mittnik et al. is an important addition to what we’ve already seen, for me mainly because it shows that largely unadmixed Western Hunter-Gatherers (WHG) lived in the South Baltic region at least as late as ~4,450 calBCE, which is the date assigned to the four Narva samples in the preprint. So now we have a plausible explanation for the inflated WHG-related ancestry in modern-day Balts and Northern Slavs.
Despite its geographically vicinity to EHG [Eastern Hunter-Gatherers], the eastern Baltic individual associated with the Mesolithic Kunda culture shows a very close affinity to WHG in all our analyses, with a small but significant contribution from EHG or SHG [Scandinavian Hunter-Gatherer], as revealed by significant D-statistics of the form D(Kunda, WHG; EHG/SHG, Mbuti) (Z>3; Supplementary Information Table S2).
…
The results for the Kunda individual are mirrored in the four later eastern Baltic Neolithic hunter-gatherers of the Narva culture (Fig. 2) and further supported by the lack of significantly positive results for the D-statistic D(Narva, Kunda; X, Mbuti) (Supplementary Information Table S2) demonstrating population continuity at the transition from Mesolithic to Neolithic, which in the eastern Baltic region is signified by a change in networks of contacts and the use of pottery rather than a stark shift in economy as seen in Central and Southern Europe [15].
…
Furthermore, the individual Spiginas2, which is dated to the very end of the Late Neolithic, has a higher proportion of the hunter-gatherer ancestry, as seen in ADMIXTURE (darker blue component in Fig. 2b), and is estimated to be admixed between 78±4% Central European CWC and 22±4% Narva (Supplementary Information Table S6). A reliance on marine resources persisted especially in the north-eastern Baltic region until the end of the Late Neolithic [29] and in combination with the proposed large population size for Baltic hunter-gatherers a ‘resurgence’ of hunter-gatherer ancestry in the local population through admixture between foraging and farming groups is likely, and has been described for the European Middle Neolithic [2,30].
https://drive.google.com/file/d/0B9o3EYTdM8lQR2NoT2U3eUljVEE/view
The only gripe I have with this manuscript are the Principal Component Analyses (PCA). They just look messy and appear to suffer from projection bias, so they’re hard to read and probably confusing for a lot of people.
Projection bias is also known as shrinkage. Basically it’s when the PCA space shrinks for the projected samples compared to the reference samples. It happens a lot in ancient DNA papers. I find it irritating. But whenever I bring up this issue with authors of these papers, I’m basically told that their PCA look like other PCA from similar papers, so there’s no problem. So, essentially, since everybody’s doing it wrong, then it’s the right way to do it. Awesome logic there.
Citation…
Mittnik et al., The Genetic History of Northern Europe, bioRxiv, Posted March 3, 2017, doi: https://doi.org/10.1101/113241
Posted by Davidski
bellbeakerblogger said…
Very satisfying to see one issue resolved, both of the Narva folk are I2a1. If I remember one of the early R1a’s in the last paper seemed to be placed between Kunda and the Early Ceramic and I thought it was a little too close to the ceramic (I can’t remember but I thought it was labelled Narva. Seems like that line is clarified a little. Still think ceramics came from East to West primarily through Baikal, despite whatever happened in Mali or whatever.
March 3, 2017 at 9:27 PM
Rob said…
@ Bell Beaker
However, Narva has ceramics and their Eastern admixture is minimal. So I think the story is a lot more complex than a simple diffusion ex Siberia
March 3, 2017 at 9:58 PM
bellbeakerblogger said…
@Rob,
I think we might be saying the same thing. Narva is almost fully WHG, but the transition from Narva to what they call the EN is pretty drastic. My thought was that the transition to the ceramic was brought by immigrants up the Volga and that’s when you start to see lineages like Karelia man and all the mtdna alphabet.
@Samuel,
Wow, that’s a stark picture of some drum-beating, canoe-paddling hunters. Almost uniformly U. Roy posted the link of the Mesolithic Sardinians. That’s some weird stuff too.
March 3, 2017 at 10:15 PM
Blogger Davidski said…
I think we might be saying the same thing. Narva is almost fully WHG, but the transition from Narva to what they call the EN is pretty drastic. I’m guessing you mean north of Lithuania? In Lithuania, and presumably Belarus, it looks like Corded Ware ran into very WHG-like Narva. By the way, I finally had a look at the Y-HG results in this paper. Not even I expected as much R1a as we’re seeing in Corded Ware. It’s almost weird.
March 3, 2017 at 10:21 PM
Romulus said…
The Narva individual Spiginas1 (dated to ca. 4440–4240 cal BCE) belongs to a mitochondrial haplogroup of the H branch providing the first direct evidence that this branch was present among European foragers without gene-flow from farmers (Extended Data Table 1)
That’s interesting.
March 3, 2017 at 10:46 PM
Blogger bellbeakerblogger said…
@Davidski
Yes, once again, I think we are saying the same thing. (It must be me). I am also surprised at the uniformity in these Hg’s. It must be the social structure of the Volga region cultures that cause y-chromosome frequencies to nearly fixate.
March 3, 2017 at 10:50 PM
Aram said…
2x I2a1 in Narva. So the Slavic I2a1 has hunter gatherer origin or farmer?
March 3, 2017 at 11:37 PM
EastPole said…
Two CWC samples Gyvakarai1 and Plinkaigalis242 lack the early farmer component also missing in EMBA Steppe samples. Gyvakarai1 is R1a-M417
“The presence of ancestry from the Pontic Steppe among Baltic CWC individuals without the Anatolian farming component must be due to a direct migration of steppe pastoralists that did not pick up this ancestry in Central Europe. This could lend support to a linguistic model that sees a branching of Balto-Slavic from a Proto-IndoEuropean homeland in the west Eurasian steppe”
So M417 is probably Baltoslavic from the steppe.
CWC from Olsund in Sweden has Balto-Slavic R1a-Z645 and is genetically more similar to Baltic CWC than to German CWC.
“This could indicate that the route of CWC expansion into Northern Sweden might have not been northward from Southern Scandinavia but instead westward across the Baltic Sea either by boat or over the frozen sea during winter”
March 4, 2017 at 12:24 AM
Davidski said…
Those Baltic_BA samples have a lot of hunter-gatherer ancestry, more than modern-day Lithuanians. That’s what those D-stats are showing. The East Asian signal in Estonians isn’t surprising. They probably got it from the same place as their N1c.
March 4, 2017 at 12:43 AM
Volodymyr Lutsyk said…
„So the Slavic I2a1 has hunter gatherer origin or farmer?”
Hunter-gatherer. The highest numbers of I2a1 are to be seen in western and central Polesie from where it spread in all directions together with early Slavic migrations. There was one I2a in Dnieper-Donets culture, in which there are clear connections with late Mesolithic Ertebelle culture
March 4, 2017 at 1:26 AM
Olympus Mons said…
Its becoming pure madness to state that r1b in western Europe came from a steppe migration and not showing up by 2500BC as bell beakers considerably mixed with R1a and even a fair amount of Q1a. Pure madness. For those who post about confirmation bias and motivational reasoning…food for thought.
March 4, 2017 at 2:11 AM
Dmytro said…
„2x I2a1 in Narva So the Slavic I2a1 has hunter gatherer origin or farmer?”
There is no doubt that the ancient paternal „Slavic” marker is of hunter gatherer origin. Currently, however, we have no certainty as to its exact whereabouts in the Neolithic and Bronze ages. None of the discovered ancient DNA (so far) is „Slavic” I2a (=CTS 10228 and subclades). Which is not too surprising since the formation time acc. to Y full is 3.300 BCE followed by a very lengthy 3,000 year „survival period”. And none of the specific aDNA markers post M-423 which „lead up” to the Slavic I2a have been found either. Only side branches, quite removed, thereof. Dnipro-Donets, Motala, Narva (here discussed) are just that. We would need an L-621 to see some possibility of ancient movement. So at the moment, the best guess is that the ancestors of the I2a Slavs were hiding just about anywhere they could not easily thrive. In „hunter-gatherer rich” areas of the north…
March 4, 2017 at 8:47 AM
Gaspar said…
Are we now saying that Narva culture is no longer Finnic in origin and ancestors of the ancient Balts?
March 4, 2017 at 9:48 AM
Volodymyr Lutsyk said…
„In „hunter-gatherer rich” areas of the north…”
Agreed. Vadim Verenich published a very extensive article on this topic. His main findings are consistent with the Doggerland theory and the movement of huge numbers of Western hunter-gatherers to the East in the 7th millenium BC (6500-6200BC). Doggerland submersion obviously played a great role in the spread of I2a in the Baltic and Eastern Europe. Though we should not rule out a much earlier presence of I2a in Eastern Europe (Swiderian culture (11000-8000BC)). But the post-6000BC movement is clearly obvious in the forest and forest-steppe zone cultures of Eastern Europe. There was a growing presence of warfare and violent deaths in that period. Its impulses even reached Volga and Ural. https://verenich.wordpress.com/2013/12/27/происхождение-гаплогруппы-i2a-и-путь-миг/
March 4, 2017 at 10:06 AM
Dmytro said…
Indeed. I read Verenich’s great study a while back. I’m not a linguist, but I found one of his later points intriguing: the notion that Slavic speech was basically formed via a „deflection” of R1a „Baltic” by the lost language of I2a HG’s. Do you happen to know the source of this idea? He has a bibliography but does not refer this point specifically.
March 4, 2017 at 10:56 AM
UWAGA!!! BARDZO WAŻNE!!!
Matt said…
OT: For the other paper we haven’t talked about much here, anyone have any thoughts about the two Mesolithic, pre-Neolithic Sardinian mtdna sequences? http://www.nature.com/articles/srep42869. I3 and J2b1, not U, suggesting the pre-Neolithic may not have been WHG / Villabruna, in which case lower degree of WHG incorporation in Sardinia compared to the rest of Europe may make sense.
Of course, there is some increased WHG compared to Anatolian, so incorporated groups must have either been richer in WHG than Anatolian, or substantial population replacement happened after the Early Neolithic (both seem likely).
They run models supporting total replacement over any admixture, but unsure how strong this modeling is, and how much it squares (or does not) with previous work earlier this year on Sardinian specific mtdna haplogroups, and with effects of culture and natural selection.
Remaining question is also how typical WHG-atypical mtdna was for South Europe below the 43rd parallel before the Neolithic. Is this general or specific only to Sardinia? Continenza (central Italy 11200 BP – 10510 BP) suggests WHG-typical mtdna was typical.
March 4, 2017 at 12:19 PM
…..
Gioiello said…
Ted Kandell con Roy King e Oleg Balanovsky a Scythia.
A new ancient DNA paper came out today that sequenced ancient Scythians. We now have 5 sequences from ancient Scythians.
Notice the R1b1a2a2-CTS1078 (R1b-Z2105).
They were at the minimum:
• R1a1a1b2-Z93
• R1b1a2a2-CTS1078
• R1a1a1b-S441
• Q1a-F903
• R1a1a1b2a2a-Z2123
Interestingly both Afontova Gora 2 (AG2) and Saqqaq Man from Greenland were Q1a-F903. It looks like the Scythians mixed with Yeniseian language speakers like the Kets and with Paleosiberians like the Koryaks.
Supplementary Table 22. Y-chromosome haplogroups
ID Y-haplogroup Polymorphisms
I0563 R1a1a1b2 Z93:7552356G->A
I0575 R1b1a2a2 CTS1078:7186135G->C, S20902:18383837C->T
I0577 R1a1a1b S441:7683058G->A
IS2 Q1a F903:7014317G->C, M1168:22155597G->A
I0247 R1a1a1b2a2a Z2123:16453077C->T
Supplementary Table 20.
Harvard ID Mainz ID Site Culture/Label Date # SNPs Sex
I0563 Be11 Berel’, Kazakhstan Pazyryk_IA 4th–3rd c. BC 420749 M
I0575 PR3 Pokrovka, Russia EarlySarmatian_IA 5th–2nd c. BC 306498 M
I0577 A10 Arzhan, Russia AldyBel_IA 7th–6th c. BC 427557 M
IS2 IS2 Ismailovo, Kazakhstan ZevakinoChilikta_IA 9th–7th c. BC 74469 M
I0247 SVP56 Nadezhdinka, Volga Steppes, Samara Scythian IA 380-200 calBCE 951,695 M
BTW, autosomally, those most descended from the Western Scythians are the Persians from Eastern Iran and the Azeris from Azerbaijan, and those most descended from the Eastern Scythians are the Tuvans from the Altai.
Unterländer et al. (2017) samples I0563, I0575, I0577, IS2:
Ancestry and demography and descendants of Iron Age nomads of the Eurasian Steppe
http://www.nature.com/articles/ncomms14615#t1
Gioiello Tognoni Sample: #YF02873 (R-Z2110) ChrY position: 8446627 (+strand) Reads: 13 Position data: 13A Weight for A: 1.0 Probability of error: 0.0 (01) Sample allele: A Reference (hg19) allele: A Known SNPs at this position: Y21707 (A->G)
Reference sequence (100bp): CTCCATGGGACCTGATTCTTGCACACAGCCTCTTTCGGGAATGAAGTCAG
A AAAGCAGTTCTCAGCGACCACCTCAGAGTTTAGAAATGCGTCCTCCAGCA
(8446576-8446677)
Sample ID HG 8446627
REFSEQ A
ERR1347675 R-Y21707 G
YF05663 R-Y21707 G
YF02873 R-Z2110* A [Gioiello Tognoni]
R-Z2108 Z2109/CTS1843 * Z21085300 ybp, TMRCA CI 95% 69005300 ybp” class=”age”formed 6100 ybp, TMRCA 6100 ybp
R-Z2108*
⦁ id:NA20866 – GIH
R-Y20993 Y20993 * KMS88 * KMS62+5 SNPs5300 ybp, TMRCA CI 95% 58003700 ybp” class=”age”formed 6100 ybp, TMRCA 4700 ybp
R-Y20993*
⦁ id:YF03134 –
R-Y21707 A12360 * A12369 * A12364+8 SNPs3700 ybp, TMRCA CI 95% 38001950 ybp” class=”age”formed 4700 ybp, TMRCA 2800 ybp
⦁ id:ERR1347675 + ДагестанреспубликаRUS [RU-DA]
⦁ id:YF05663 + IRQ [IQ-DQ]
Of course all that demonstrates all what I am saying from ten years, i.e. that the sample of R1b from Samara belonged to a tiny subclade of R-L23 comes very liukely from West (but we’ll see next data) and above all that my R-Z2110 is the ancestor of CTS7556>Y5572 >CTS9219….
March 3, 2017 at 11:18 PM
Blogger Krefter said…
New post at my blog….
http://mtdnaatlas.blogspot.com/2017/03/more-ancient-eastern-european-mtdna.html
David 47% H in the Bronze age looks like the work of natural selection or massive female migration to me.
March 3, 2017 at 11:36 PM
Aram said…
Krefter „” or massive female migration to me. „”
Or massive female founder effects. Females can also have founder effects alongside their successful husbands. They just need to have 1.2 surviving daughters per each generation.
Do You have Y DNA spreadsheets for Bronze Age? Please post it if yes.
March 3, 2017 at 11:55 PM
Blogger Aram said…
Iosif Lazaridis has tweets on Scythians „”Tweet from Iosif Lazaridis:
„The Scythians of the eastern steppe were seemingly derived from Yamnaya and East Eurasian ancestors And not from temporally closer Sintashta/Andronovo populations that carried EEF ancestry Similar to present-day South Asians who are best modelled with Early/Middle Bronze Age steppe not Andronovo/Sintashta.”””
March 4, 2017 at 12:00 AM
Blogger Davidski said…
eah, maybe, strange though that these eastern Scythians share Y-DNA with Sintashta, not Yamnaya.
March 4, 2017 at 12:06 AM
Blogger Aram said…
Davidski
Imho this increases the chances that we will see a lot off R1as in Yamna.
March 4, 2017 at 12:08 AM
Davidski said…
So who wants to bet that one of the western Yamnaya groups will be identical to Gyvakarai1, Plinkaigalis242 and Ardu2, including a shitload of Z645?
Place your bets.
March 4, 2017 at 3:12 AM
Matt said…
If so, they should be autosomally identical to Yamnaya (based on the ADMIXTURE – the different Baltic_LN are actually labelled, in white on a white background), with maybe a small offset of less CHG>more HG. No Anatolian.
In the PCA, the 6 Baltic_LN aren’t labelled. Some overlap Steppe_MLBA and presumably these are the relatively Anatolia heavy samples with typical HG component – Plinkaigalis241, Kunila2 and some RISE samples I can’t make out on the legend.
Then there are two clear outliers. One overlaps the Baltic_BA and this is presumably Spiginas2, a sample about 25% richer in HG ancestry than the other Baltic_LN which is very similar to Baltic_BA in ADMIXTURE. The other is at the very edge of the Yamnaya/Steppe EMBA cluster – so either Plinkaigalis242 / Gyvakarai1, mirroring their „No Anatolia; typical HG” status in the ADMIXTURE.
March 4, 2017 at 3:33 AM
Blogger Gioiello said…
TED KANDELL oder THE EVIDENCE
Evidence? Everyone has understood that Samara was composed of hg. R1a and a little of R1b-L23. That they migrated to Baltic carrying the Balto-Slav languages (no R1b has been found amongst them) and migrated to Andronovo and Sintashta as Indo-Iranian and gave birth to Scythians of Iranian languages. The tiny R1b subclade, only belonging to the R-L23-Z2105 subclade with perhaps some extinct line, was in those migrations (above all carrying hg. R1a) till Mongol/Chinese/Turk people and after also to the Indian subcontinent where a few of those haplotypes may have survived. But from these samples survived in Eastern Europe, Caucasus, Middle East only a few subclades different from the Western European ones which anyway didn’t derive from them. I have explained in my previous letters which subclades may have been derived from these haplotypes there and which not.
Evidence? You lack:
R-M335
R-V88 and all subclades (not older in Africa and Middle East than 5000 years)
R-L389+ (except the haplotype with YCAII=23-23 found in Armenia, wherea Italy has all the 4 hts known so far)
R-Z2109-Y4512 only in Western Europe
R-Z2110 and subclades found in Western Europe and back migrated Eastward as CTS9219
R-M269
R-L51
R-L11
R-U106
R-P312 and all the Western European subclades…
Evidence?
March 4, 2017 at 4:00 AM
SKRBH 
Uwielbiam tę szeroką skórkę!!! :-0 …i to dlatego zaznaczyłem jak chciałem, to co wynika z tego REWOLUCYJNEGO wg mnie. badania…
Rozumiecie już, że te dane są BARDZO GRUBE?!!
Patrzcie:
https://en.wikipedia.org/wiki/Swiderian_culture
Zasięg kultury świderskiej
Swiderian culture, also published in English literature as Sviderian and Swederian, is the name of Final Palaeolithic cultural complexes in Poland and the surrounding areas. The type-site is Świdry Wielkie, in Otwock near the Swider River, a tributary to the Vistula River, in Masovia,. The Swiderian is recognized as a distinctive culture that developed on the sand dunes left behind by the retreating glaciers. Rimantiene (1996) considered the relationship between Swiderian and Solutrean „outstanding, though also indirect”, in contrast with the Bromme-Ahrensburg complex (Lyngby culture), for which she introduced the term „Baltic Magdalenian” for generalizing all other North European Late Paleolithic culture groups that have a common origin in Aurignacian.[1](…)
https://en.wikipedia.org/wiki/Kunda_culture
Kunda Culture, with its roots in Swiderian culture,[1] is a mesolithic hunter-gatherer communities of the Baltic forest zone extending eastwards through Latvia into northern Russia dating to the period 8000–5000 BC by calibrated radiocarbon dating. It is named after the Estonian town of Kunda, about 110 kilometres (70 mi) east of Tallinn along the Gulf of Finland, near where the first extensively studied settlement was discovered on Lammasmäe Hill and in the surrounding peat bog.[2] The oldest known Kunda culture settlement in Estonia is Pulli settlement. The Kunda Culture is succeeded by the Narva culture who use pottery and show some traces of food production.(…)
https://en.wikipedia.org/wiki/Narva_culture
Narva culture or eastern Baltic (c. 5300 to 1750 BC)[1] was a European Neolithic archaeological culture found in present-day Estonia, Latvia, Lithuania, Kaliningrad Oblast (former East Prussia), and adjacent portions of Poland, Belarus and Russia. A successor of the Mesolithic Kunda culture, Narva culture continued up to the start of the Bronze Age. The technology was that of hunter-gatherers. The culture was named after the Narva River in Estonia.(…)
PolubieniePolubienie
O kurcze!!! Patrzcie:
https://en.wikipedia.org/wiki/Narva_culture
(…)
Technology and artifacts
The people of the Narva culture had little access to flint; therefore, they were forced to trade and conserve their flint resources.[2] For example, there were very few flint arrowheads and flint was often reused. The Narva culture relied on local materials (bone, horn, schist). As evidence of trade, researchers found pieces of pink flint from Valdai Hills and plenty of typical Narva pottery in the territory of the Neman culture while no objects from the Neman culture were found in Narva.[2] Heavy use of bones and horns is one of the main characteristics of the Narva culture. The bone tools, continued from the predecessor Kunda culture, provide the best evidence of continuity of the Narva culture throughout the Neolithic period. The people were buried on their backs with few grave goods.[2] The Narva culture also used and traded amber; a few hundred items were found in Juodkrantė. One of the most famous artifacts is a ceremonial cane carved of horn as a head of female elk found in Šventoji.[3]
The people were primarily fishers, hunters, and gatherers. They slowly began adopting husbandry in middle Neolithic. They were not nomadic and lived in same settlements for long periods as evidenced by abundant pottery, middens, and structures built in lakes and rivers to help fishing.[2] The pottery shared similarities with Comb Ceramic culture, but had specific characteristics. (…)
https://en.wikipedia.org/wiki/Comb_Ceramic_culture
Neolithic period
The Pit–Comb Ware culture or Comb Ceramic culture was a northeast European culture of Pit–Comb Ware-making hunter-gatherers. It existed from around 4200 BCE to around 2000 BCE. The name is derived from the most common type of decoration on its ceramics, which looks like the imprints of a comb.
The distribution of the artifacts found includes Finnmark (Norway) in the north, the Kalix River (Sweden) and the Gulf of Bothnia (Finland) in the west and the Vistula River (Poland) in the south. In the east the Comb Ceramic pottery of northern Eurasia extends beyond the Ural mountains to the Baraba steppe adjacent to the Altai-Sayan mountain range, merging with a continuum of similar ceramic styles.[1] It would include the Narva culture of Estonia and the Sperrings culture in Finland, among others. They are thought to have been essentially hunter-gatherers, though e.g. the Narva culture in Estonia shows some evidence of agriculture. Some of this region was absorbed by the later Corded Ware horizon.
Ceramics
The Pit–Comb Ware culture is one of the few exceptions to the rule that pottery and farming coexist in Europe. In the Near East farming appeared before pottery, then when farming spread into Europe from the Near East, pottery-making came with it. However, in Asia, where the oldest pottery has been found, pottery was made long before farming. It appears that the Comb Ceramic Culture reflects influences from Siberia and distant China.[2]
The ceramics consist of large pots that are rounded or pointed below, with a capacity from 40 to 60 litres. The forms of the vessels remained unchanged but the decoration varied.
By dating according to the elevation of land, the ceramics have traditionally (Äyräpää 1930) been divided into the following periods: early (Ka I, c. 4200 BC – 3300 BC), typical (Ka II, c. 3300 BC – 2700 BC) and late Comb Ceramic (Ka III, c. 2800 BC – 2000 BC).
However, calibrated radiocarbon dates for the comb-ware fragments found (e.g., in the Karelian isthmus), give a total interval of 5600 BC – 2300 BC (Geochronometria Vol. 23, pp 93–99, 2004).
Among the many styles of comb ware there is one which makes use of the characteristics of asbestos: Asbestos ware. Other styles are Pyheensilta, Jäkärlä, Kierikki, Pöljä and Säräisniemi pottery with their respective subdivisions. Sperrings ceramics is the original name given for the younger early Comb ware (Ka I:2) found in Finland. (…)
Language
Previously, the dominant view was that the spread of the Comb Ware people was correlated with the diffusion of the Uralic languages, and thus an early Uralic language must have been spoken throughout this culture. However, another more recent view is that the Comb Ware people may have spoken a Paleo-European (pre-Uralic) language, as some toponyms and hydronyms also indicate a non-Uralic, non-Indo-European language at work in some areas.[4] Even then, linguists and archaeologists both have also been skeptical of assigning languages based on the borders of cultural complexes, and it’s possible that the Pit-Comb Ware Culture was made up of several languages, one of them being Proto-Uralic.[citation needed](…)
…..
Jak dla mnie POZAMIATANE!!! 🙂
PolubieniePolubienie
Skribho, a nie dałoby się tego jakoś streścić w 5 zdaniach?
Co takiego tam znalazłeś, albo czego tam brakuje?
PolubieniePolubienie
Tam NIE MA haplogrupy N,.. czyli Ugro-Finowie nie pojawili się tam wcześniej niż R1a, patrz nawet około 5000 lat później!!!
Dodatkowo NIE BYŁO TAM ZŁÓŻ KRZEMIENIA, który był pewno przywożony z… Krzemionek Opatowskich, na ten przykład, itd…
Poczytaj, co zaznaczyłem na czerwono…
PolubieniePolubienie
O to jest dobre:
http://www.historycy.org/index.php?showtopic=124442&st=60
http://www.historycy.org/index.php?s=96e04830381bbc1330f967c3beef5ccd&showtopic=124442&view=findpost&p=1425196
Pewne sprostowanie – te datacje to zdaje się TMRCA (time of most recent common ancestor = wiek najbliższego wspólnego przodka).
Czyli same linie mogą być starsze niż wiek TMRCA, ale przed czasem TMRCA ich populacje nie mogły być raczej zbyt liczne (chyba, że nastąpiła jakaś demograficzna katastrofa i efekt szyjki butelki). Tak zdaje się jest w przypadku R1a-M417 (czyli R1a1a) bo ten łowca-zbieracz z Karelii to właśnie ta linia (czy raczej bezpośredni przodek tej linii), podobnie łowca-zbieracz z Samary to R1b-M269 (czy raczej bezpośredni przodek tej linii).
Zarówno łowca z Karelii jak i ten z Samary żyli nieco wcześniej niż TMRCA znacznej większości współczesnego R1a oraz R1b. Tak więc nie ma 100% pewności, że to właśnie ich pra-pra-prawnuki były tymi TMRCA (w tym wspólnym przodkiem 99% współczesnego R1a), ale jest duże prawdopodobieństwo, że to oni albo ktoś kto żył w pobliżu (czytaj: również we wschodniej Europie). Bo skoro te linie były wtedy nieliczne, to raczej nie zajmowały dużych obszarów. Natomiast skoro ich przedstawicieli sprzed 7500 lat znaleziono odpowiednio w Karelii i w Samarze, to ciężko oczekiwać by ich bliscy krewniacy (takie same linie ojcowskie dla ogromnej większości współczesnego R1a i R1b) żyli wtedy gdzieś daleko od Karelii i Samary – na przykład na Bliskim Wschodzie czy w Indiach. Jest to mocny dowód na wschodnioeuropejskie pochodzenie przodka (MRCA) znacznej większości współczesnych R1a i R1b.
Łowca z Karelii:
In contrast to I0104 and I0099, the hunter-gatherer from Karelia could only be assigned to haplogroup
R1a1 (M459:6906074A→G, Page65.2:2657176C→T) and the upstream haplogroup R1a
(L145:14138745C→A, L62:17891241A→G, L63:18162834T→C, L146:23473201T→A). It was
ancestral for the downstream clade R1a1a (M515:14054623T→A, M198:15030752C→T,
M512:16315153C→T, M514:19375294C→T, L449:22966756C→T). Thus, it can be designated as
belonging to haplogroup R1a1*(xR1a1a) and it occupied a basal position to the vast majority of
modern Eurasian R1a-related Y-chromosomes4 (…) Overall, our detection of haplogroup R1a1 in a
northwest Russian hunter-gatherer establishes the early presence of this lineage in eastern Europe, and
is consistent with a later migration from eastern Europe into central Europe which contributed such
haplogroups to the Corded Ware population.
Najbardziej istotny fragment po polsku:
„(…) Był ojcowski dla pochodnego kladu R1a1a (…) Wobec tego, można go zakwalifikować do haplogrupy R1a1* (xR1a1a), która jest bazowa dla ogromnej większości współczesnych euro-azjatyckich chromosomów Y związanych z R1a. (…) Generalnie, odkrycie haplogrupy R1a1 u łowcy-zbieracza z północno-zachodniej Rosji dowodzi wczesnej obecności tej linii genetycznej we wschodniej Europie, i jest w zgodzie z późniejszą migracją ze wschodniej Europy do środkowej Europy, która wniosła takie haplogrupy do ludności kultury ceramiki sznurowej.”
Teraz łowca z Samary:
The hunter-gatherer from Samara belonged to haplogroup R1b1 (L278:18914441C→T), with
upstream haplogroup R1b (M343:2887824C→A) also supported. However, he was ancestral for both
the downstream haplogroup R1b1a1 (M478:23444054T→C) and R1b1a2 (M269:22739367T→C) and
could be designated as R1b1*(xR1b1a1, R1b1a2). Thus, this individual was basal to most west
Eurasian R1b individuals which belong to the R-M269 lineage as well as to the related R-M73/M478
lineage that has a predominantly non-European distribution17. The occurrence of chromosomes basal
to the most prevalent lineages within haplogroups R1a and R1b in eastern European hunter-gatherers,
together with the finding of basal haplogroup R* in the ~24,000-year old Mal’ta (MA1) boy18
suggests the possibility that some of the differentiation of lineages within haplogroup R occurred in
north Eurasia (…) Irrespective of the more ancient origins of this group of lineages, the occurrence of basal
forms of R1a and R1b in eastern European hunter-gatherers provide a geographically plausible source
for these lineages in later Europeans where both lineages are prevalent4,17,19.
Najbardziej istotny fragment po polsku:
„(…) był ojcowski zarówno dla pochodnych R1b1a1 oraz R1b1a2 i można go określić jako R1b1* (xR1b1a1, R1b1a2). Tak więc, ten osobnik był bazowy dla większości osób z haplogrupą z R1b z zachodniej Eurazji, które należą do linii R-M269 jak też do pokrewnej linii R-M73/M478, która występuje głównie poza Europą. Wystąpienie chromosomów bazowych dla najbardziej dominujących linii w ramach haplogrup R1a oraz R1b u łowców-zbieraczy z Europy Wschodniej, wraz ze znalezieniem bazowej haplogrupy R* u chłopca sprzed 24,000 lat w miejscowości Mal’ta, sugeruje możliwość, że część różnicowania się linii w ramach haplogrupy R miało miejsce w północnej Eurazji (…) Niezależnie od bardziej starożytnych początków tej grupy linii Y-DNA, wystąpienie bazowych form R1a oraz R1b u łowców-zbieraczy z Europy Wschodniej dostarcza nam geograficznie prawdopodobnego źródła rozprzestrzenienia się tych linii wśród późniejszych Europejczyków, gdzie obie te linie są dominujące.”
Miejscowość Mal’ta znajduje się na Syberii.
Ogólnie te odkrycia zdają się potwierdzać teorię o wschodnioeuropejskim pochodzeniu Proto-Indo-Europejczyków. Już wcześniej wielokrotnie zwracano uwagę na fundamentalne podobieństwa między językami ugro-fińskimi i indo-europejskimi, a także wzajemne bardzo wczesne pożyczki. Wydaje się, że praojczyzna PIE była w pobliżu praojczyzny ugro-fińskiej, gdzieś między Morzem Bałtyckim a stepem pontyjsko-kaspijskim na południu oraz Uralem na wschodzie. Prawdopodobnie w strefie laso-stepu a może lasu na północ od zachodniej części stepu pontyjsko-kaspijskiego.
Co do tego R1a pochowanego w Karelii na wyspie Oleni na jeziorze Onega – on tam nie mieszkał za życia, bo ta wyspa była niezamieszkana, używano jej jako cmentarzyska (właściwie dwa cmentarzyska, z których korzystały dwie odrębne populacje) – tutaj więcej na ten temat:
http://what-when-how.com/ancient-europe/ol…ancient-europe/
Czyli Proto-Indo-Europejczycy byli potomkami wschodnioeuropejskich łowców, którzy udomowili konia, przeszli do pasterstwa, itd. Z lasu i laso-stepu zeszli na południe i zaludnili step, zmieniając formy gospodarowania. Prawdopodobnie mieszali się też z ludnością na południe od stepu (pewnie stąd autosomalna domieszka „Ormiano-podobna” w kurhanach – może brali sobie żony z południa lub jakaś imigracja stamtąd?).
PolubieniePolubienie
Cały wpis:
http://what-when-how.com/ancient-europe/oleneostrovskii-mogilnik-postglacial-foragers-80004000-b-c-ancient-europe/
OLENEOSTROVSKII MOGILNIK (POSTGLACIAL FORAGERS, 8000–4000 B.C.) (Ancient Europe)
As the mists were lifting above the lake, a small boat—a dugout canoe—was taking the chieftain’s body on his last journey, beyond the water toward the island of the dead. Like a shadow, the island emerged from the mist, surrounded by the dark green waters of Lake Onega. The shaman pounded his drum; the elders wielded symbols of their community, shaped in the image of the moose; and the boatmen hurried on to release their load. As the boat drew closer to the shore, a pair of swans took off from the shallows. This was a good omen. They were taking with them the soul of the deceased, his freed and timeless soul, northward to the underworld, and the mood of the living lifted with the mists. The soul of the old chieftain was about to be buried amid feasting and ceremonies, together with his earthly remains, symbols of office, ceremonial dagger and other weapons, headdress, pendants and necklaces, and various other possessions. Rays of the early summer sun broke through the cloud, more than eight thousand years ago.
In local folklore Oleneostrovskii Mogilnik (also called Olenii Ostrov or Deer Island) was known as the island of the dead, but it was not until the mid-twentieth century that the local population discovered that the island held the largest Mesolithic cemetery in Europe. More than eight thousand years ago people were buried there, and the picture sketched here is based on a reconstruction of events occurring at that time (fig. 1). The body in the rich grave numbered 100 may indeed have belonged to a shaman or a chieftain.
Located on a small island within Lake Onega in Karelia, the cemetery was discovered as a consequence of quarrying activities in the 1920s, and many of the graves were destroyed or disturbed before excavation. Excavated by Soviet archaeologists in the 1930s and 1950s, the cemetery was subsequently interpreted in several different ways. In all, archaeologists managed to excavate 177 burials in 141 distinct mortuary features, but the total number of burials must have been nearer 500. Radiocarbon dating of the skeletons places the cemetery in a period between 6400 and 6000 b.c. This unexpectedly early date is fully consonant with the Mesolithic character of artifacts from the site.
Plan of Oleneostrovskii Mogilnik cemetery.
Fig. 1. Plan of Oleneostrovskii Mogilnik cemetery.
It seems that two groups, possibly lineages or clans, were using Oleneostrovskii Mogilnik. This is evident from two spatial clusters within the cemetery: the northern cluster is associated with moose sculptures (fig. 2) and the southern cluster with snake and human effigies. The snake and human representations seem to be combined into a single zooanthropomorphic tradition, different from the northern group, whose identity was symbolized by moose representations. Thus, two separate populations shared the use of Oleneostrovskii Mogilnik. The northern cluster was used by people with northern European and Uralic features, more indigenous to the area, while the southern area was used by people with southern European and Siberian features, who might have been newcomers to the area. This interpretation underlines the genetic heterogeneity of the people who used the cemetery. Rather than supporting the existence of two distinct, non-communicating groups, these graduated differences in appearance and genetic makeup instead may reflect „unimpeded gene flow” across the forest zone of eastern Europe, brought about by long-distance travel, intermarriage, and partner exchange that was usual among the northern hunter-gatherer populations.
Moose-headed terminal from graves at Oleneostrovskii Mogilnik cemetery.
Fig. 2. Moose-headed terminal from graves at Oleneostrovskii Mogilnik cemetery.
In all, 7,132 artifacts were found with the burials, and the vast majority consisted of the pierced incisors of moose (4,372 pieces) and beavers (1,155 items) and bear tusks (170 artifacts), modified to hang as a part of a headdress, pendant, or necklace. The remaining artifacts included six bone daggers, thirteen flint and sixty slate ritual knives, carved bone or stone pendants, and fourteen sculptures made of antler. More utilitarian tools included harpoons, fishhooks, sinkers, awls, needles, flint blades, scrapers, spearheads, and arrow points made from both bone and flint. Unworked animal bones were relatively rare and included those of beaver, reindeer, moose, wolf, bear, and dog.
The number and composition of grave goods, together with burial arrangements and elaboration of the graves, formed the basis of mortuary analysis and interpretation of the social composition of the Oleneostrovskii society. Such mortuary analysis revealed the existence of at least seven social dimensions, expressing band membership; social differentiation related to gender, age, and personal wealth; and three other specialized ranks. Gender distinctions were expressed through the articles placed in the graves of the deceased. Bone points, bone harpoons, axes, flakes, and slate knives were associated with males. An absence of implements but inclusion of ornaments and perforated beaver incisors was associated with females.
The types of perforated tooth pendants exhibited a clear hierarchical order relative to each other, which corresponded to the number and variety of other goods found in the graves. Graves with bear tusks denoted the wealthiest people, followed by graves containing either moose or beaver incisors, and, finally, graves with no pendants. These wealth ranks varied with age, so that the adults possessed the greatest quantities, while the young and the old had fewer goods. Such age-dependent change was less pronounced among females, possibly indicating that female wealth markers were obtained through either affinal or consanguine ties to males.
In four shaft graves at Oleneostrovskii Mogil-nik, there are interments that are significantly different from the others, and in terms of grave architecture, treatment of the body and the grave goods relate to shamanistic roles and symbols. In contrast to the others, these graves are oriented westward. They include two males, one female, and one juve-nile—in a seated or reclining position. Their interpretation as shamans’ graves relies on their western orientation (while others faced east), which can be explained as facing the entrance to the underworld, the domain of spirit ancestors of the shamans and of the rulers of the underworld. The recovery of beaver mandibles from one of these graves reinforces the argument, since mandibles of beaver form part of the shamans’ attire among some Siberian groups, in reference to the perceived medicinal and ritual qualities of the beaver. The presence of beaver incisors in the shaft graves, irrespective of sex, is significant, as this category of pendants normally is associated with females at Oleneostrovskii Mogilnik. Both men and women took on the shaman’s role as spiritual mediator with the underworld; consequently, the shaman’s robe retained symbols of both genders.
Two other special ranks are represented at the cemetery. The first can be seen in a series of eleven individuals, all male, who were interred with bone projectile points as the sole grave good, suggesting the presence of a sodality, or all-male hunting group with special abilities or responsibilities connected to hunting. The second rank is represented by a set of nine graves—two in the southern cluster and seven in the northern one—where the deceased were buried with carved effigies. This social status could be held by adults of either sex and was most common among older individuals. It was independent of personal wealth, as all three wealth ranks were represented among these burials. The apparent relationship between the effigies and the spatially separate clusters of the cemetery suggests that these persons held some office or social position related to the central ritual identity of the bands. The range of ages among the officeholders (from adolescent to old) and the independence from personal wealth may suggest an ascriptive or hereditary dimension to this social position.
The elaborate burial in grave 100 represents one of the shaft burials, where the individual, a robust middle-aged male, was buried in a reclining position. The deceased was sent off to another world with more than five hundred artifacts carefully placed over and around his body, particularly around the head and shoulders, around the pelvic region, and below the knees. This arrangement suggests that some of the pendants were attached to what was perhaps a funeral garment and possibly a headdress. The deceased was equipped with a quiver that held arrows and a large bone dagger with flint inserts. It has been suggested that the placement of these artifacts, the almost vertical positioning of the body, and other features of the burial rite indicate that the deceased was exposed for viewing intentionally, so as to produce a memorable visual effect.
The construction of the grave was equally elaborate. The body was buried in a long pit covered in ochre, sealed by a layer of sand, and topped by large stones. Possibly, an external sign, such as a wooden pole, marked the location of the burial. There were three other persons interred in such vertical or sloping shaft graves. Both males and females could assume this social status, and it seemed to have a positive correlation with an individual’s wealth, as three of the four individuals possessed grave assemblages of the highest wealth level. The range of artifacts and the conditions of burial are consistent with one researcher’s observation that these are the graves of ritual specialists, or shamans. It was the shamans, or the effigy holders, who were most likely to act as community elders or chieftains.
In summary, while the ritual roles could be inherited (as evidenced by child or juvenile effigy holders), the wealth could not. It tended to decline in old age. Such patterned decline in status goods with age may reflect intergenerational circulation of symbolic artifacts as age- and gender-related social roles were passed from one age group to another. Much of the grave equipment reflected the age and sex-specific social role of an individual at the time of death. At the same time, both men and women could acquire a high-status position, although men tended to acquire higher rank more often than did women.
Over what period of time was Oleneostrovskii Mogilnik used? The length of use and the frequency of interments have a major bearing on the broader significance of the cemetery. O’Shea and Zvelebil’s reconstruction of the Oleneostrovskii Mogilnik cemetery and its society suggests that a community of about four hundred to five hundred people used the cemetery. The duration of its use was relatively brief, perhaps 80 to 120 years, or four to six generations. Other researchers have identified chronological differences between the northern and southern clusters within the cemetery and posit a longer period of use, perhaps as long as five hundred years. On the available evidence, this would mean one burial every three years.
Even if we accept that the total number of people buried was about five hundred, it would mean that there was about one burial per year. Used so intermittently, Oleneostrovskii Mogilnik could not have acted effectively as an ideological and eth-nocultural sacral center, a necropolis founded by a chieftain ancestor that was central to the identity of the group, or a focus for seasonal gatherings meant to maintain extensive social ties of the broader community. Even though burial of people at Oleneostrovskii Mogilnik probably was selective, its adduced function would have required one or two ceremonial gatherings per year (late spring and early autumn). This would suggest a shorter, rather than longer episode of use, on the order of one hundred to two hundred years.
Oleneostrovskii Mogilnik is only one among several burial grounds in northern and circum-Baltic Europe displaying such mortuary variation. Other similar cemeteries have been found in Scandinavia, Northwest Russia, and the eastern Baltic. Mortuary analysis of major burial grounds, such as Oleneostrovskii Mogilnik, Skateholm (Sweden), or Zvejnieki (Latvia), indicates that many of the Meso-lithic communities in northern and eastern Europe correspond to the „delayed-return” foragers in the ethnographic record (i.e., foragers invest in food-procuring activities that have long-term results, such as building fish weirs or dams). Social structure in the Mesolithic appears to have been more hierarchically ranked than was the case among the more complex hunter-gatherers of modern times. Status distinctions along the major social dimensions of age, sex, and achieved status are discernible in general terms, and there is evidence for inherited social differentiation (inherited social stratification) at Skateholm, Zvejnieki, and Oleneostrovskii Mogil-nik as well as at other cemeteries along the Atlantic coast in Denmark, France, and Portugal.
The Oleneostrovskii Mogilnik cemetery also gives a wealth of information about the cosmologi-cal beliefs held by the Mesolithic hunter-gatherers. This system of beliefs, structured by analogy to more modern Siberian shamanism, is based on the concept of a three-tier universe (upper or sky world, middle or earth world, and the underworld associated with water, ocean, and the north). The tiers are linked by a turu, or a tree of life, providing a conceptual axis linking the three worlds. It is further based on the existence of more souls than one, including at least the free soul and the body soul. The body soul is manifested by breathing and it lives and dies with an individual; the free soul enters a human or an animal at birth, perhaps from an ancestor, and departs at death to the underworld, or sometimes to the upper world depending on the status of the individual. Communication takes place between human beings and deities, spirits, and animal beings for the benefit of the whole living community. Most communication was conducted by shamans with the help of spirits, among whom the most prominent took the shape of waterbirds (as swimmers and fliers that could lead the shaman to all three worlds), bear (as the master of other animal beings), and moose or deer (as a messenger celestial being, a guide to the heavens, and a link between the three worlds). Artifacts at Oleneostrovskii Mogilnik are replete with symbolism that can be understood by reference to these meanings, and similar motifs and symbols are replicated on rock carvings and paintings of the region, as at Besov Nos on Lake Onega, on the White Sea petroglyphs, and elsewhere in northern Europe.
It is within this ritual and cosmological context that people from the Oleneostrovskii Mogilnik community were buried—often on islands or promontories; marked by ritual separation by water from settlements; and guided by animal spirits, such as images of swans, duck, or moose and deer, to the other worlds. Ceremonies involved extraterrestrial communication by shamans with the aid of ritual equipment: the drum, mask, headdress, bag, and bones or images of ritually significant animals— beaver, snake, waterbirds, deer, and bear. Finds at the cemetery reflect this ritual code of practice.
In such ways, people of the Oleneostrovskii Mogilnik community and beyond—indeed, the people of the Mesolithic in northern and temperate Europe—could make sense of the world around them. With the aid of such understanding, they could organize their social roles and relationships and negotiate with one another for power, prestige, and social standing in the community within an accepted code of practice. These social roles and social standings were played out and remembered in rituals surrounding death and symbolized by artifacts deposited in their burials. Oleneostrovskii Mogil-nik, together with other burial grounds, offers an exceptionally informative and specific glimpse into the social lives and communal beliefs of hunting and gathering people eight thousand years ago.
Next post: INTRODUCTION (TRANSITION TO AGRICULTURE, 7000–4000 B.C.) (Ancient Europe)
http://what-when-how.com/ancient-europe/introduction-transition-to-agriculture-70004000-b-c-ancient-europe/
Previous post: THE MESOLITHIC OF EASTERN EUROPE (POSTGLACIAL FORAGERS, 8000–4000 B.C.)
http://what-when-how.com/ancient-europe/the-mesolithic-of-eastern-europe-postglacial-foragers-80004000-b-c/
PolubieniePolubienie
http://www.historycy.org/index.php?showtopic=124442&view=findpost&p=1423500
lukaszrzepinski 12/02/2015
QUOTE(Robert01 @ 12/02/2015, 12:57)
Wnioski z tego płynące są zgodne z najbardziej spodziewanym scenariuszem, jaki wynikał z badania obecnej populacji, a mianowicie widac jak na dłoni, chociaż nie to było celem pracy, że R1a wyewoluował w Europie środkowej. W tej pracy widzimy to na przykładzie Z280, ale nie inaczej będzie z M458, a także Z284.*
szybko zarobisz ostrzezenie i/lub bana jeśli jeszcze nie zarobiłeś, po pierwsze za brak kultury, po drugie za kompletnie nieuprawnione wnioski… gdybasz sobie i to bardzo grubo…
1. kto się spodziewał tego scenariusza ze był taki najbardziej spodziewany?
2. co to wnosi do dyskusji? Ze nie inaczej będzie z M458? Nie inaczej tzn gdzie w Europie środkowej ta grupa wyewoluowała? W Rumunii, w Polsce czy na Ukrainie? Bo z owego „nie inaczej” nie wyciągam zadnych wniosków
I jak doszedłeś do wniosków ze w Europie środkowej? Wypadałoby podać szersze uzasadnienie
3. dlaczego uwazasz ze „skrzętnie” (czyli ze szczególną starannością) pominięto skoro próbki pochodzą z całych 7 krajów? Wobec tego większość Europy moze czuć się skrzętnie pominięta
A teraz co do samej pracy… faktycznie przełomowa
Eulau jest omówione krótko…
Robert01: 12/02/2015
QUOTE
– praca chyba obala pretensje Słowian co do najblizszego pokrewieństwa z protoIndoeuropejczykami skoro stepowcy mieli az tyle R1B;
Tak, potwierdza indoeuropejskość R1b, którego w Indiach nie ma wcale. Ten absurd potęguje niezaprzeczalny fakt naukowy, że R1b ze stepów było już indoeuropejskie(jak jest w tej pracy opisane), zanim … Ariowie (R1a Z93) weszli do Indii.
W tej pracy widać ten nonsens ubrany w szaty naukowości.
Podtrzymuję to co napisałem wczesniej, R1b nie jest żadną miarą indoeuropejskie.
lukaszrzepinski 12/02/2015
QUOTE
– praca chyba obala pretensje Słowian co do najblizszego pokrewieństwa z protoIndoeuropejczykami skoro stepowcy mieli az tyle R1B;
Tak, potwierdza indoeuropejskość R1b, którego w Indiach nie ma wcale.
Celny strzał… Cóz, sama praca zauwaza ze ekspansja indoeuropejska ze stepów nie jest aksjomatem… A historycy hinduscy uwazają ze R1A do Europy przyszło z Indii północnych właśnie
Robert01 12/02/2015
Pobyt R1b w k.jamowej nie dowodzi, że ona ma tam swoje centralne żródło, skłaniam sie do tych, którzy twierdzą, że tym źródłem był jednak Bliski Wschód, dawny Lewant. Implikuje to gałąż afrykańska. Zaskoczeniem jest taka duza ilośc R1b, ale nie za duzym -wystarczy popatrzec na mapę współczesnego rozkładu R1b w zachodniej Azji, także w Rosji, połowa R1b z k.Yamna, to właśnie ich przodkowie.
Największym zaskoczeniem jest „genetyczny dziadek M417”, sprzed 7000-7500 lat, znaleziony hen w Kareli. To stawia kolejne argumenty w temacie balto-słowiańskim, czyli mieszanki N oraz R1a, czyli, kto był pierwszy, że jednak R1a było pierwsze?
Domen 12/02/2015
QUOTE
Trzecia najstarsza, aż z północnej Rosji, z Kareli, reliktowa R1a1, potocznie dziadek M417, datowana na 7000-7500 lat. Wszystkie dotąd pozyskane próbki kopalnego R1a z Europy znaleziono na peryferiach obecnego zasięgu R1a. Ilustruje to poniższa mapa (czerwone kropki to miejsca znalezienia starożytnego R1a):
Późny Mezolit:
kultura (czas), stanowisko(a):
Łowca-Zbieracz (5500 p.n.e.), wyspa na jeziorze Onega (Karelia)
Epoki miedzi-brązu:
kultura (czas), stanowisko(a):
Kultura Ceramiki Sznurowej (2600 p.n.e.), Eulau (Saksonia-Anhalt)
Kultura Ceramiki Sznurowej (2400 p.n.e.), Esperstedt (Turyngia)
Tocharowie, Jedwabny Szlak (2020 – 1940 p.n.e.), Xiaohe (Kotlina Tarymska – Xinjiang, zachodnie Chiny)
Kultura Andronowska (1800 – 1400 p.n.e.), Solenoozernaïa (rejon Krasnojarska) i Oust-Abakansty (Chakasja)
Scytowie (1370 p.n.e.), Tsagaan Asga (Ałtaj Mongolski)
Kultura Łużycka (1050 p.n.e.), Halberstadt (Saksonia-Anhalt)
Scytowie (1010 p.n.e.), Takhilgat Uzuur (Ałtaj Mongolski)
Krąg Kultur Pól Popielnicowych (1000 p.n.e.), jaskinia Lichtenstein (Dolna Saksonia)
Epoka żelaza:
kultura (czas), stanowisko(a):
Kultura Tagar (800 p.n.e. – 100 n.e.), Czernogorsk, Oust-Abakansty, rejon Bijska (Kraj Ałtajski), rejon Bogradu
Kultura Pazyryk (450 p.n.e.) – Dolina Sebystei (nieopodal Kosz-Agacz, Ałtaj)
Xiongnu (300 – 100 p.n.e.), Duurlig Nars (wschodnia Mongolia)
Kultura Tachtyk (100 – 400 AD), rejon Bogradu (Chakasja)
Na terenie wschodnich Niemiec mamy 7 mężczyzn z R1a odkopanych w 4 miejscach:
Cztery miejsca w Niemczech, gdzie znaleziono starożytne R1a, są położone bardzo blisko siebie:
Nadal wielka „czarna dziura” między Rosją a Niemcami…
Domen 13/02/2015
QUOTE („AlexanderMalinowski2”)
Jeśli wziąć to literalnie, to nie pochodzimy od azjatyckich barbarzyńców ze stepów Ukrainy, tylko od środkowo Europejczyków.
To nie do końca tak. Przez stepy Ukrainy chyba też się przewinęliśmy, tylko nie wiadomo skąd tam przyszliśmy. Na pewno haplogrupa R1a licznie partycypowała w stepowych populacjach indoeuropejskich (patrz chociażby kultura andronowska – na 10 mężczyzn aż 9 to R1a, w dodatku z kilku stanowisk – obecny rezultat dla kultury jamowej to 7 mężczyzn ale wszyscy z tego samego stanowiska – koło Samary).
Natomiast teraz wiemy, że zarówno R1b jak też R1a były obecne w Europie Wschodniej jeszcze zanim pojawili się kurhanowcy (mamy bowiem łowcę-zbieracza R1b z rejonu Samary, który żył ok. 5640 – 5555 lat p.n.e. i łowcę-zbieracza R1a z Karelii, który żył ok. 5500 – 5000 p.n.e.).
Ci dwaj łowcy R1b i R1a (mapa niżej) mogli żyć nawet prawie równocześnie (przyjmując skrajne daty 5555 p.n.e. i 5500 p.n.e.)!
Ten gość R1a z Karelii to jak dotąd najstarsze odkryte kopalne R1a. Z kolei R1b prawie tak samo stare – bo z ok. 5178 – 5066 p.n.e. – z wczesnego neolitu, odkryto w północno-zachodniej Hiszpanii, w Els Trocs – ale nie jest to R1b+M269+L23+, a więc większość współczesnego R1b w Europie NIE pochodzi od kladu tego konkretnego wczesnego rolnika z Hiszpanii!
Mamy więc potwierdzone R1b w Europie Zachodniej w neolicie, ale taki klad, którego potomkowie są dzisiaj nieliczni!
Natomiast R1b u łowcy-zbieracza spod Samary – który żył tam na całe 2000 lat przed pojawieniem się kultury grobów jamowych – to R1b-P297+, czyli „ojcowski” klad zarówno dla europejskiego M269 jak też dla azjatyckiego M73+ (!).
Czyli chyba większość współczesnego R1b w Europie Zachodniej, to przybysze z Europy Wschodniej po roku 3000 p.n.e. (!)
Tutaj mamy tych wschodnioeuropejskich łowców-zbieraczy z R1a (Karelia) i z R1b (Samara), obaj z VI tysiąclecia p.n.e.:
Żyli mniej więcej w tym samym czasie, ok. 1250 km od siebie, ale genetycznie byli bardzo podobni (w DNA autosomalnym):
Co ciekawe – mimo różnych haplogrup – pod względem autosomalnym obaj ci łowcy byli do siebie bardzo podobni! Stanowili komponent EHG (Wschodni Łowcy-Zbieracze) – który wygląd tak jakby składał się w ok. 60% z WHG i 40% z ANE, wg. definicji tychże WHG i ANE z publikacji z 2004 „Ancient human genomes suggest 3 ancestral populations for present-day Europeans”. EHG to Wschodni Łowcy-Zbieracze, WHG to Zachodni Łowcy-Zbieracze a ANE to Dawni Północni Eurazjaci. EHG wyglądało tak jakby byli mieszanką 60% WHG z 40% ANE.
Co ciekawe – nie było wśród nich (tych łowców-zbieraczy R1a i R1b) praktycznie wcale komponentu EEF (Pierwsi Europejscy Rolnicy).
Oczywiście EEF pochodzili z okolic Bliskiego Wschodu – Kaukazu – Anatolii (do Europy weszli przez Bałkany). Jak widać ominęli wschód.
Koljena sprawa – R1b z kultury grobów jamowych wyglądają już autosomalnie inaczej niż ten łowca-zbieracz (mimo, że też R1b i nawet każdy z nich mógł być potomkiem tego łowcy). Doszedł bowiem autosomalny komponent, który przypomina współczesnych Ormian. W rezultacie „Jamowcy” z Samary to genetycznie mieszanka ok. 50% EHG (Wschodnich Łowców Zbieraczy) i ok. 50% „jakby Ormian” (!). Ale jakie haplogrupy przynieśli ze sobą ci „Ormianie”? Bo już o 2000 lat wcześniejsi EHG zawierali w sobie zarówno R1b jak też R1a. Więc R1b, które wykryto u 7 mężczyzn z kurhanów mogło być miejscowe (potomkowie łowców-zbieraczy), albo i nie. Natomiast z „Ormianami” mogło przybyć albo więcej R1b, albo raczej jakaś inna haplogrupa (której akurat nie wykryto u tych 7 zbadanych mężczyzn z jednego cmentarzyska kultury grobów jamowych).
Czyżby „jakby Ormianie” też mieli R1a lub R1b, tylko inne (lub nawet te same) klady ??? Czy coś innego niż R1?
Rekonstrukcja twarzy (autor: M.M. Gerasimow) tego łowcy-zbieracza z Karelii, o którym teraz wiadomo, że był R1a:
Więcej pod tym linkiem:
http://www.kunstkamera.ru/en/temporary_exh…l/gerasimov/10/
QUOTE
Znaleziono tam też czaszki o cechach laponoidalnych (mówiący w jęz. uralskich, z Y-DNA hg N1c1 ?), ale były w zdecydowanej mniejszości.
Swoją drogą to według (jeszcze nieopublikowanych) wyników badań Chińczyków, R1a Tocharów z Kotliny Tarymskiej pochodziło z Europy (nie było to Z93, tylko Z282). Z komentarzy do tego artykuł (artykuł z 2010, komentarz z 2014 – napisany przez współautora artykułu):
http://www.biomedcentral.com/1741-7007/8/15
QUOTE Hui Zhou (2014-07-18 16:14) Jilin University
Our results show that Xiaohe settlers carried Hg R1a1 in paternal lineages, and Hgs H, K, C4, M*in maternal lineages. Though Hg R1a1a is found at highest frequency in both Europe and South Asia, Xiaohe R1a1a more likely originate from Europe because of it not belonging to R1a1a-Z93 branch (our recently unpublished data) which is mainly found in Asians. mtDNA Hgs H, K, C4 primarily distributed in northern Eurasians. Though H, K, C4 also presence in modern south Asian, they immigrated into South Asian recently from nearby populations, such as Near East , East Asia and Central Asia, and the frequency is obviously lower than that of northern Eurasian. Furthermore, all of the shared sequences of the Xiaohe haplotypes H and C4 were distributed in northern Eurasians. Haplotype 223-304 in Xiaohe people was shared by Indian. However, these sequences were attributed to HgM25 in India, and in our study it was not HgM25 by scanning the mtDNA code region. Therefore, our DNA results didn’t supported Clyde Winters’s opinion but supported the “steppe hypothesis”. Moreover, the culture of Xiaohe is similar with the Afanasievo culture. Afanasievo culture was mainly distributed in the Eastern Kazakhstan, Altai, and Minusinsk regions, and didn’t spread into India. This further maintains the “steppe hypothesis”.
In addition, our data was misunderstand by Clyde Winters. Firstly, the human remains of the Xiaohe site have no relation with the Loulan mummy. The Xiaohe site and Loulan site are two different archaeological sites with 175km distances. Xiaohe site, radiocarbon dated ranging from 4000 to 3500 years before present, was a Bronze Age site, and Loulan site, dated to about 2000 years before present. Secondly, Hgs H and K are the mtDNA haplogroups not the Y chromosome haplogroups in our study. Thirdly, the origin of Xiaohe people in here means tracing the most recently common ancestor, and Africans were remote ancestor of modern people.
Czyli indoeuropejscy Tocharowie z Xiaohe to haplogrupa R1a. Ale nie gałąź azjatycka (Z93) tylko raczej R1a, które przybyło do Chin bezpośrednio z Europy (!). Bliżej się dowiemy o co dokładnie chodzi, gdy już to opublikują.
Domen: 18/02/2015
W świetle nowych odkryć, ta mapa wydaje się dobrze przedstawiać kolebkę PIE (między Bałtykiem, Uralem i stepem pontyjsko-kaspijskim):
http://steppeasia.pagesperso-orange.fr/images/andronovo3.jpg
Szacunkowy wiek powstania i czasu życia najbliższego wspólnego przodka:
1) Dla całego Y-DNA:
http://www.yfull.com/tree/A0-T/
2) Dla kladów R1a:
http://www.yfull.com/tree/R1a/
3) Dla kladów R1b:
http://www.yfull.com/tree/R1b/
Robert01: 26/02/2015
<img src=”http://i1076.photobucket.com/albums/w443/priwas/a19103cc4d67.png
https://www.academia.edu/9452168/Archaeology_of_lake_settlement_IV-II_mill._BC_Mazurkevich_A._Polkovnikova_M._Dolbunova_E._ed
Okolice Smoleńska i Pskowa, nad gorna Dźwiną całkiem niedaleko Polski, podobniez jak probki archeologicznego R1a ze środkowych Niemiec, jeszcze tysiąc lat temu ziem Słowian Połabskich. Jedna probka ma pomiędzy 6000 a 5000 lat, dwie kolejne około 4500 lat oraz jedna próbka 2600 lat. Na wschodzie dodaję probkę z pracy Haak i inni, z Kareli, datowaną na 7500 lat, a co najwazniejsze, ta linia żyje do dzisiaj na Bialorusi jest oznaczona u pana Szpakowskiego jako R1a YP1272, podobno druga osoba jest w drodze do publikacji.
Na wschodzie, mamy zatem R1a sprzed 7500 lat, 5500 lat, 4500 lat i 2600lat. Dla porównania z pracy „Haak i inni” plus Eulau z 2008 roku, środkowe Niemcy, tereny dawnych Słowian, są to: 4600 lat, 4400lat i 3100 lat.
Podsumowując.
W pseudosporcie zwanym boksem, istnieje pojęcie ‚egzekucja’, gdy jeden z zawodników jest bezsilny nie mogąc dosiegnąć rywala, natomiast rywal nie kończy walki trzema uderzeniami, tylko powoli i notorycznie obija twarz przeciwnikowi doprowadzając do dużego uszczerbku na zdrowiu. Patrząc na to w jaki sposób genetycy publikują dane o R1a, stwierdzam, że przeprowadzają ww.’egzekucję’ na allochtonistach, zamiast szybko zakończyć ten spektakl publikacją trzech probek R1a z terenu Polski, mamy to co w zestawieniu powyżej.
PolubieniePolubione przez 1 osoba
Kurcze!!! Kolejny podobny artykuł, czyli w sumie stary, bo z Lutego, właśni ego przeglądam… 🙂
http://eurogenes.blogspot.co.uk/2017/02/neolithic-transition-in-baltic-paper-1.html
A to bardzo polecam, choć to „brunatni:
http://www.historycy.org/index.php?showtopic=124442&st=60
Kopalne DNA a migracje Indoeuropejczyków
PolubieniePolubienie
http://eurogenes.blogspot.co.uk/2017/02/neolithic-transition-in-baltic-paper-1.html
Thursday, February 2, 2017
Neolithic transition in the Baltic
Open access at Current Biology:
Jones at al., The Neolithic Transition in the Baltic Was Not Driven by Admixture with Early European Farmers, Current Biology, Published Online: February 02, 2017, DOI: http://dx.doi.org/10.1016/j.cub.2016.12.060
See also…
First look at Latvian and Ukrainian ancient genomes
Posted by Davidski
Samuel Andrews said…
The Baltic Hunter Gatherers had R1b1 but were much closer to WHG than to WHG. Maybe R1b1 is a WHG lineage.
February 2, 2017 at 1:18 PM
Rob said…
Matt
The MN Latvians are U4. IIRC, they’ve been found in Mesolithic Motala and Germany, as well as Siberians
February 2, 2017 at 1:18 PM
Rob said…
Sam
The maximal „diversity” of R1b is in Southern/SEE Europe . This has been known for long time
February 2, 2017 at 1:21 PM
Samuel Andrews said…
@Rob, „The maximal „diversity” of R1b is in Southern/SEE Europe . This has been known for long time”
We still don’t know where WHG is orignally from or even exactly what it is. They could be very mixed, a hyprid who remained isolated for 1,000s of years, acquired drift, then expanded. They could be from Spain, Italy, SE Europe, pretty much any plot of land that wasn’t covered in Ice 20,000+ years ago.
ElMiron died in Spain 20,000 years ago, had mtDNA U5b, and had lots of affinity to WHG. Therefore we shouldn’t be confident WHG originated in SouthEast Europe.
February 2, 2017 at 1:25 PM
Samuel Andrews said…
Baltic HG mtDNA…. U5a1=2(U5a1c=1), U4=2(U4a1=1), U2e1=1
Those are lineages which have been considered EHG. pre-U2e has found Paleolithic Belgium, early forms of U2’3’4’7’8’9 have been found all over Paleolithic Western Europe. So the reason Baltic HGs and EHG had similar mtDNA could be because EHG’s mtDNA is mostly WHG(ultimaty Paleo Western European).
February 2, 2017 at 1:21 PM
EastPole said…
“The presence of a Steppe-related component in Latvia_LN1 in the absence of an Anatolian farmer-related genetic input supports a Steppe rather than an Anatolian origin for the Balto-Slavic branch of the IndoEuropean language family.”
This is interesting and indeed may be the clue to the origin of Corded Ware, and Balto-Slavic and Indo-Iranian languages. Such a hypothesis comes to my head:
PIE most likely originated somewhere on the step. Split into two main dialects associated with R1a and R1b before the admixture with EEF. So for example Early Corded Ware could come from Late Sredny Stog Dereivka culture. When it migrated North and West it spoke an early Balto-Slavic. Then mixed with EEF in Poland and evolved into early Slavic: after that it migrated north-east and mixed with some Balto-Slavic groups and HGs and became Balts; the CWC which migrated east later mixed with some steppe groups and became Indo-Iranians.
February 2, 2017 at 1:26 PM
Davidski said…
Lack of any sort of ancient R1b in Balts means there was a population turnover from the MN to LN in the East Baltic, and it came from the steppe with people who carried R1a-M417. R1b-M269 also comes from the steppe. I don’t see the results in this paper changing that perception. It’s a pity the Ukrainian foragers were females.
February 2, 2017 at 1:31 PM
Shaikorth said…
Ukrainian HG indeed does look like EHG sans ANE, closer to Karelia but not to MA-1 compared to Bichon and Loschbour.
Mbuti MA1 Bichon Ukraine_HG1 0.0062 0.520
Mbuti Karelia Loschbour Ukraine_HG1 0.0269 2.451
Mbuti Karelia Bichon Ukraine_HG1 0.0348 3.069
Ukrainian Neolithic and Mesolithic are quite equally lacking in CHG:
Mbuti Kotias Bichon Ukraine_HG1 0.0054 0.494
Mbuti Kotias Bichon Ukraine_N1 0.0057 0.551
February 2, 2017 at 2:28 PM
Nirjhar007 said…
But still oldest R1b is from Italy and there is someone, who will laugh and say its coming from there !.
Eastpole, The dates can even be contemporary of Yamnaya and they most likely predate, anything like ‚Balto-Slavic’ . We also don’t have the Y-dna .
And certainly R1b-R1a split predates PIE and its pre forms by thousands and thousands of years. If you say the emergence of R1a-M417 and M-269 , that is another issue .
February 2, 2017 at 8:26 PM
EastPole said…
@Nirjhar007 Read the paper. They write about Neolithic Corded Ware sample Latvia_LN1:
“this individual lived around the time of later date estimates (4,500–7,000 cal BP) proposed for the split of Proto-Balto-Slavic from other Indo-European languages”
I think there were two different early PIE dialects, one associated with R1a and the other with R1b. Otherwise why didn’t they mix if they spoke the same langugee.
February 2, 2017 at 10:53 PM
Davidski said…
I hope these BAM files come online soon. I reckon there’s a chance that the Latvian MN sample, the Comb Ceramic one, is N1c. The Latvian Corded Ware LN is probably R1a-Z280. The Ukrainian foragers might be R1b and/or R1a.
February 3, 2017 at 12:05 AM
…..
Tylko Davidski wspomniał o jednym przypadku N1 podobno znalezionym w Comb Ceramic!!! N1 przyszło nad Bałtyk bardzo późno i NIE MOGŁO BYĆ OBECNE W EUROPIE WCZEŚNIEJ NIŻ R1a!!! 🙂
Bałtowie i ich języki powstały jako późna nakładka języka/ów jakichś N1a, nałożonych na… starożytny podkład językowy EGH, jak tego Karelczyka z R1a M417!!! TADA!! 🙂
PolubieniePolubienie
Zobaczcie to:
http://eurogenes.blogspot.co.uk/2015/01/ancient-dna-points-to-eurasian-steppe.html
Monday, January 19, 2015
Ancient DNA points to the Eurasian steppe as a proximate source for Indo-European migrations into Europe
This is yet another teaser for the upcoming Corded Ware/Yamnaya paper from the Reich lab. Sadly, it doesn’t mention Y-chromosome haplogroups, so perhaps the authors are going to tackle this issue later. However, check out what they say about the German and Spanish farmers being of the same stock, and the resurgence of hunter-gatherer ancestry in Western Europe after the early Neolithic. Fascinating stuff.
Source: INA Kolloquium Ws 2014/15
Update 11/02/2015: Massive migration from the steppe is a source for Indo-European languages in Europe (Haak et al. 2015 preprint) .
Posted by Davidski 2015-01-19
Wcześniej w Wschodniej Europie byli czyści EHG, którzy w prostej linii wywodzili się od Chłopca z Mal’ta R1 z nad Bajkału, i… około TYLKO 5000 lat temu ZASTĄPILI ich potomkowie TYCH SAMYCH EGH, ALE ZMIESZANI JUŻ z DNA kobiet ze Skałkazu!!!
Człowiek z Karelii BYŁ R1a M417 i EGH!!! Yamnaya było TYLKO jego zmieszanym potomkiem!!! Skoro Yamnaya ma być PPIE… to KIM BYŁ CZYSTY POTOMEK R1 Z KARELII?!!
PZDRWM
SKRiBHA
PolubieniePolubienie
Sława Skribha – co powiesz o tej ilustracji.
Droga z Bajkału do Europy Centralnej -to pierwsza linia, którymi Nasi Przodkowie przywędrowali dla mnie ze Światłej Bramy.
Rosjanie potwierdzają, i dalej wałkują viedunów.
Rosjanie dalej twierdzą, że na Północy stała cywilizacja z przed 25000 lat, dzisiaj pozostało po niej tylko morze i lód, ciekawostka – naukowa:
miejsce te zostało oznaczone, cechuje się tym, że dochodzi tam często gęsto do nie wyjaśnionych zjawisk – Kozyriev rosyjski badacz, stwierdził, że może to być miejsce po Atlantach, gdy Ziemia nie miała Księżyca, a sama oś ziemska była przechylona w taki sposób, źe Europa Centralna wyznaczała biegun – na ile to prawda – sami naukowcy już też się za głowę łapią, skoro nasz układ planetarny przeczy prawu Keplera – to znaczy jedno: próbuje się nam otwierać tylko te drzwi, które nie wywrócą yahwistycznej teorii ewolucji do góry dnem.
U nich cały czas żywe podania o Swiatłorusach, i Raseńcach, Aryach.
Powstawanie i upadki cywilizacji sa wpisane, więc mogło tak być, że kultura Vinca jest odbudowaną kulturą praSlovYan, i nie oznacza, że ktoś był pierwszy, tylko tyle, że siła i wola życia naszych genów jest taka, że sama siebie niszczy by potem odbudować sie silniejsza.
Jesteś Racjonalistą Skribha, masz otwarty umysł, lecz nie zamykaj się na inne dziedziny – dzisiaj wszystko i wszystkich można kupić, kazdy wpis spreparować, by bronić tego, czego tak bardzo nie lubimy. Sława
PolubieniePolubienie
Przykro mi, ale ja nie zajmuję się fantastyką, czy fantazją. Pytaj tych, którzy w tym siedzą, bo ja siedzę TYLKO W ŹRÓDŁACH!!! 🙂
PolubieniePolubienie
Sława Skribha, a co jeśli źródła są skażone?!!!! Wiem jesteś Racjonalsitą – Lem też był fantastykiem, Verne, – no i cóż – czas pokazał, że oni byli wizjonerami, a Putin idzie dalej swoją drogą, i nim skończymy tutaj w gąszczu potoczków, i rwących rzek dojść do prawdziwego źródła, On zakręci kureczek – nie tylko z gazem. Wiesz, znam się na socjotechnice, przez to uważam, że robisz dobra pracę, ale brak Ci troszkę abstrakcyjnego myślenia, alternatywnego, – i przyjmujesz wszystko to co zachodnie źródła piszą, Widzę, co się dzieje na katedrach fizyki kwantowej, może się okazać, że Swiat zostanie wywrócony do góry nogami, a My nadal sobie dokuczamy. Trzeba iść do przodu, nie koniecznie drogą yahwistycznej relacji dowodowania, że człowiek pochodzi od małpy – bynajmniej jak twierdzą Indianie Hopi, Darwin może pochodzi od małpy, ale My nie. No cóż, udowadnianie kto ma racje, na poziomie interpersonalnym prędzej czy później hołduje swemu Ego, i próby wywarcia presji na „bycie” przywódcą stada- takie to wyhodowane, zasiane, i jak widać, wszędzie marny plon. Pozdrawiam Cie.
Wiecej pozytywizmu i romantyzmu – dobrej energii.
PolubieniePolubienie
Jakie źródła są skażone, czym Lepszy jest brak źródeł?
Przy okazji ciekawostka:
KaR+aC”/T”
KaZ+aC”/T”
Czy Z/S+KaR”+oNe, czy Z/S+KaZ”+oNe..?
PolubieniePolubienie
Wskaż SKRIBHa chodź jedno niezależne, samofinansujące się laboratorium, grono naukowców zajmujących się tym co przytaczasz pracujących dla wolności – NIE MA w EUROPIE, USA, CHINACH, ROSJI – wszystko jest upolitycznione, pod pręgieżem religijnym, pod płaszczykiem rządzących tym światem.
Myślisz SKRIBHa, że ktoś coś ci daje w taki sposób abyś to sam odkrył – nic bardziej mylnego. Jeśli masz biliony i rządzisz bankami – rządzisz ideologią, a ona mówi jedno – pochodzisz od Noego – to samo dotyczy RudaiWeb, nie wspomnę o największym ulubieńcu „diabelique autentice” który ideologicznie pasuje jak ulał do tego o czym piszę.
Przekonaj UW, czy UJ do zmiany poglądów, choćbyś się z kupy rozsypał – grant zachodni jest tak silny, że będzie fałszować próbki, przedstawiał fałszywe dokumenty, polemike, publikował fałszywe „dowodowania naukowe”, a im bardziej będziesz starał się im udowodnić, że to ma sens, że praSlovYanie są kolebką cywilizacji Europejsko-Azjatyckiej, tym bardziej będziesz narażony nie na ataki z ich strony lecz na wmanewrowanie Cię w taki sposób abyś sam się przyznał do błędu. Ja wiem, że to oczym piszecie, pokrywa się w 60% z tym co ja wiem, co potrafię odczytać ze starożytnych inskrypcji, które też są zmienione, – nie ma starożytności o czym uczą w szkołach, jest oficjalne, i propagowane – nie ma takiej historii.
SKRIBHa podziwiam to co robisz, i pisz dalej – ale nie daj się wciągnąć. Z serca Ci tego życzę.
Ten świat z którego czerpiesz jest iluzją, pokoju, wiedzy, życia.
Kim i skąd pochodzi Nasz ROD – jeszcze nie teraz jak widze o tym można mówić. Slava.
PolubieniePolubienie
Ok,.. jakieś wnioski? Wiesz co to jest PORÓWNYWANIE DANYCH, na czym to polega i co za pomocą tego narzędzia można osiągnąć..hm? Wolałbym coś popartego czymkolwiek, bo nie mam ani czasu ani tym bardziej chęci rozmawiać o ogólnych ogółach. Proszę o dowody na poparcie tych słów. Proszą mnie dobrze zrozumieć…
PolubieniePolubienie
SKRIBHA – uwierzę, jeśli w Polsce zaczną badać DNA starożytnych grobowców ( jak narazie po cichu każdy taki egzemplarz jest rozjeżdżany przez spychacze) – jak narazie cisza aby pobrano próbki ( teraz się wzięli za kopiec Wandy) , w Rosji – gdyby nie fakt, że pewne dane wyciekły do prasy naukowej – to fakt pojawienia się R1 na stepach Syberii i Bałchaszu szacunkowo 16500 lat temu, to albo człowiek żył bardzo długo, i współplemieńcy musieli mieć inną krew – skoro nauka datuje i próbuje syntezować pod postacią R1a1a1b+ mutacja, dopiero w przedziale czasowym ok. 8 tys. lat temu – takim bądź razie albo ramy czasowe oficjalnej nauki się zawężają aby udowodnić biblijny potop, albo ktoś robi ludziom wodę z mózgów.
Każde pokolenie ma swoją historie genetyczną, to skąd u licha taki krótki łańcuch skoro Rosjanie mają dowody na toż że R1 i R1A jest dużo starsze. Czy ministerstwo kultury Rosji ma w tym interes, czy raczej naukowe dowody SKRIBHa, że zachód się myli – a myli się, bo za Sxxxxxxka nie chce przekroczyć granicy 10000 lat wcześniej,gdyż to eliminuje praktycznie ich wiodącą ideologie, babilońską. W samej Rosji jest dopiero propaganda, gdzie na równi stawia się Germańców, Bałtów i Slowian dopiero od II w. n.e. – ale to zrozumiałe wszak cerkiew to inna forma tej samej babilońskiej „zołzy” patrz mamałygi.
W 1925r. w Waszyngtonie powstało tajne stowarzyszenie naukowe, które ma kontrolować wszystko to co się dzieje w historii człowieka ( znasz przypadki nadawania nagród Nobla – skoro chcesz dowodów – jaki procent stanowią Słowianie? a panowie wybrani?), cóż SKRIBHa, życzę ci dalszych poszukiwań, lecz pamiętaj – oni będą manipulować, po to aby ogłupiać – to nie chodzi o to kto jest kim, ale kto ma prawo do ZIEMI.
Będą tworzyć fikcyjne strony, fikcyjne dane, fikcyjną rzeczywistość – wsciekasz się o ksenofobie, rasizm – więc, że najwiekszymi rasistami są religie, nie zwykli ludzie. Pewnych procesów nauczania człowiek nie mógł sam wymyśleć – jest to nie możliwe, jeśli nie mógł, to gdzieś to zaobserwował i musiał mieć do tego narzedzię, lub ktoś go tego nauczył – przykład – Free Energy – zjawisko prądu elektrycznego i cała metodologia i terminologia oparta własnie na kupczeniu, grancie, geszefcie owych wybrańców. Wiesz co determinuje życie – przyjemność i energia – jeśli te dwa stałe czynniki są uniwersalne – to skąd nagle wzięło się tylu ludzi – skoro dopiero co zeszli z drzew gdzieś w Zimbabwe, czy w Kamerunie – za nic mi to nie pasuje, nie w tych ramach czasowych o których piszecie, nie wg oficjalnej nauki. Jedzenie to energia, prokreacja to przyjemność, jakby tak nie było – to wg oficjalnej nauki nas by nie było. Skąd więc ludzie wiedzieli – że można pożenic te dwie sprawy – ze swiata zwierząt – nie sądzę. Są proste pytania – na które trudno znaleźć odpowiedź. Nic nie dzieje się z przypadku.
Sława.
PolubieniePolubienie
Porównuj dane i myśl samodzielnie… Głowa do góry, przyśpieszenie wgniata w fotel… hehehe
PolubieniePolubienie
Duuużo tego nawrzucałeś. Miej litość dla czytelników.
Napisałeś do Roberta „Karelczyk to czyste EHG R1a M417” Pewien jesteś, ze M417?, zawsze mi się wydawało, że M420.
„tzw. Yamnaja to z okolic stepu WSZYSTKO ZMIESZANE ZE SOBĄ,” Yamnaja miała R1b. I pamiętam, ze była modelowana 60% HG i 40% Kaukaz.
„TAM NIE MA JUŻ R1a M417, tylko Z93, patrz Afanasiewo, jako wschodnia Yamnaya!!!” Na pewno w Afanasjewo było Z93?
„Tym razem ostatecznie urwę mu jego pusty łeb” A to o czym?
A do mnie: „Tam NIE MA haplogrupy N,.. czyli Ugro-Finowie nie pojawili się tam wcześniej niż R1a, patrz nawet około 5000 lat później!!!” Niby tak, ale Robert gdzieś znalazł bardzo stare „N” w północno zachodniej Rosji. Czyli panowie z „N” już znacznie wcześniej penetrowali wschodnią Europę i nie wiadomo jak daleko na zachód zabrnęli. Nie wiadomo również, którą z kolei migracją na zachód byli Finowie. Wiadomo jedynie, że „N” od Finów/Estończyków migrowało circa 2600 lat temu, a „N” od Bałtów ok. 2000 lat temu. Nie wiem również skąd była domieszka wschodnia u łowców skandynawskich. Pomimo, że należeli do hg I2 nie byli WHG jak ich europejscy kuzyni. Potraktowano ich przydomkiem SHG, ze względu na domieszkę wschodniego HG. Przypuszczam, że to domieszka od R1a lub R1b, ale nie można chyba wykluczyć „N”. Gdzieś czytałam, że SHG opuściło Skandynawie po wkroczeniu rolnictwa i przeniosło się na wschód, bodajże nad wschodni Bałtyk – Dniepr. ( O nawet o tym pisze Alissa i ali)
„Skribho, a nie dałoby się tego jakoś streścić w 5 zdaniach?” To może jakiś ogólny zarys twoich ostatnich „odkryć” mógłbyś przedstawić?
Co mają „N” do starożytności języka litewskiego i innych bałtyjskich? Z tego co skumałam z wypowiedzi zajmujących się genetyką userów korespondujących ze Sławomirem, uważa się starożytne języki bałtyjskie za wypowiadane przez R1a (Z280 albo jakąś jej część). Więc pewnie i kultury z tą hg związane uważają za bałtyjskie. Wyraźnie w każdym razie promują Bałtów.
PolubieniePolubienie
(…) Napisałeś do Roberta „Karelczyk to czyste EHG R1a M417” Pewien jesteś, ze M417?, zawsze mi się wydawało, że M420.(…)
MI zawsze wydawało się, że M417, ale nie dam się za to pokroić. Żeby było śmieszniej, to nie wiem gdzie mogę coś na ten temat znaleźć pewnego!!! Szukałem i szukałem i poddałem się! 😦 Ktoś coś wie, o źródle na te dane? Sieć pokazuje wszystko po bokach…
http://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1003296
Ancient DNA Reveals Prehistoric Gene-Flow from Siberia in the Complex Human Population History of North East Europe
Clio Der Sarkissian, Oleg Balanovsky, Guido Brandt, Valery Khartanovich, Alexandra Buzhilova, Sergey Koshel, Valery Zaporozhchenko, Detlef Gronenborn, Vyacheslav Moiseyev, Eugen Kolpakov, Vladimir Shumkin, Kurt W. Alt, Elena Balanovska,
Abstract
North East Europe harbors a high diversity of cultures and languages, suggesting a complex genetic history. Archaeological, anthropological, and genetic research has revealed a series of influences from Western and Eastern Eurasia in the past. While genetic data from modern-day populations is commonly used to make inferences about their origins and past migrations, ancient DNA provides a powerful test of such hypotheses by giving a snapshot of the past genetic diversity. In order to better understand the dynamics that have shaped the gene pool of North East Europeans, we generated and analyzed 34 mitochondrial genotypes from the skeletal remains of three archaeological sites in northwest Russia. These sites were dated to the Mesolithic and the Early Metal Age (7,500 and 3,500 uncalibrated years Before Present). We applied a suite of population genetic analyses (principal component analysis, genetic distance mapping, haplotype sharing analyses) and compared past demographic models through coalescent simulations using Bayesian Serial SimCoal and Approximate Bayesian Computation. Comparisons of genetic data from ancient and modern-day populations revealed significant changes in the mitochondrial makeup of North East Europeans through time. Mesolithic foragers showed high frequencies and diversity of haplogroups U (U2e, U4, U5a), a pattern observed previously in European hunter-gatherers from Iberia to Scandinavia. In contrast, the presence of mitochondrial DNA haplogroups C, D, and Z in Early Metal Age individuals suggested discontinuity with Mesolithic hunter-gatherers and genetic influx from central/eastern Siberia. We identified remarkable genetic dissimilarities between prehistoric and modern-day North East Europeans/Saami, which suggests an important role of post-Mesolithic migrations from Western Europe and subsequent population replacement/extinctions. This work demonstrates how ancient DNA can improve our understanding of human population movements across Eurasia. It contributes to the description of the spatio-temporal distribution of mitochondrial diversity and will be of significance for future reconstructions of the history of Europeans.
http://www.forumbiodiversity.com/showthread.php/44375-Allentoft-et-al-2015-Population-genomics-of-Bronze-Age-Eurasia/page33
http://www.theapricity.com/forum/showthread.php?14101-Finns-in-a-Genetic-Class-of-their-Own/page4
http://www.eupedia.com/forum/archive/index.php/t-32990.html
arvistro
18-10-16, 20:32
It isn’t. Narva and Kunda cultures were autosomally WHG, not EHG. Yamna and EHG admixtures came only with Corded Ware culture. Kunda too? Ok, it is also derived from Swiderian, so, could be.
Tomenable
18-10-16, 19:48
So the high Yamna admixture in the Baltic may only be shared ancestry older than Yamna. It isn’t. Narva and Kunda cultures were autosomally WHG, not EHG.Yamna and EHG admixtures came only with Corded Ware culture.
TRAFIONY ZATOPIONY!!! Jest tam tego od groma, i muszę to poczytać do końca! Szukam o M417, czy M420 i nic, ale znalazłem to, co znalazłem, a to było napisane już 5mcy wcześniej!!! 🙂
(…) „tzw. Yamnaja to z okolic stepu WSZYSTKO ZMIESZANE ZE SOBĄ,” Yamnaja miała R1b. I pamiętam, ze była modelowana 60% HG i 40% Kaukaz.(…)
Tak, tyle że to 60% to jest TAKŻE R1a od Karelczyka + R1b z południa + ormiańskie żony ze Skałkazu… i to wszystko potem CZĘŚCIOWO WRÓCIŁO DO DOMU, CZYLI NA PÓŁNOC I ZACHÓD!!! 🙂
(…) „TAM NIE MA JUŻ R1a M417, tylko Z93, patrz Afanasiewo, jako wschodnia Yamnaya!!!” Na pewno w Afanasjewo było Z93?(…)
100% R1a w Afanasiewo to Z93!!! Patrz na dane, które zamieściłem w tabelce, tu:
http://eurogenes.blogspot.co.uk/2017/03/r1b-m269-in-afanasievo.html
https://drive.google.com/file/d/0B9o3EYTdM8lQWWRud1dzYWQzUW8/view
(…) „Tym razem ostatecznie urwę mu jego pusty łeb” A to o czym? (…)
Poczekaj do końca tego tygodnia, to sama przekonasz się, co zrobię z takim jednym schizofrenicznym krętaczem, co to jak czegoś nie rozumie, to zawsze to jest „wina Putina”, który żeby „obronić” R1a na Bałkanach 10,000 lat temu, użył filmiku było nie było nakręconego z okazji wykładu naukowca z Rosyjskiej Akademii Nauk, który rzekomo potwierdził, tę bytność… To kolejne schizo, żeby jednego „ruskiego trolla” próbować załatwić wykładem innego „ruskiego trolla”… Trzeba mieć naprawdę pusto w głowie, żeby sobie na takie coś pozwalać, no nic… Pokażę mondrość tego „łowcy ruskich trolli”,.. przy okazji pokażę jakie mondrości napisał Kliosow (i Tomazoli),.. którego „łowcy ruskich trolli” normalnie kochają… Czy to nie przeurocze? 🙂
(…) A do mnie: „Tam NIE MA haplogrupy N,.. czyli Ugro-Finowie nie pojawili się tam wcześniej niż R1a, patrz nawet około 5000 lat później!!!” Niby tak, ale Robert gdzieś znalazł bardzo stare „N” w północno zachodniej Rosji. Czyli panowie z „N” już znacznie wcześniej penetrowali wschodnią Europę i nie wiadomo jak daleko na zachód zabrnęli. Nie wiadomo również, którą z kolei migracją na zachód byli Finowie. Wiadomo jedynie, że „N” od Finów/Estończyków migrowało circa 2600 lat temu, a „N” od Bałtów ok. 2000 lat temu. Nie wiem również skąd była domieszka wschodnia u łowców skandynawskich. Pomimo, że należeli do hg I2 nie byli WHG jak ich europejscy kuzyni. Potraktowano ich przydomkiem SHG, ze względu na domieszkę wschodniego HG. Przypuszczam, że to domieszka od R1a lub R1b, ale nie można chyba wykluczyć „N”. Gdzieś czytałam, że SHG opuściło Skandynawie po wkroczeniu rolnictwa i przeniosło się na wschód, bodajże nad wschodni Bałtyk – Dniepr. ( O nawet o tym pisze Alissa i ali)(…)
Ok, a masz na to „stare” N jakieś źródła? Ja ostatnio gdzieś znalazłem jedną próbkę, i to chyba tylko coś około 2800 lat temu… To jest 2000 lat MŁODSZE od próbek R1a, o których napisałem, nie mówiąc nawet o Karelczyku!!! 🙂 O czym tu gadać?!!! Sprawdź sama tabelki…
(…) „Skribho, a nie dałoby się tego jakoś streścić w 5 zdaniach?” To może jakiś ogólny zarys twoich ostatnich „odkryć” mógłbyś przedstawić? (…)
Już napisałem i zacytowałem tu:
https://skrbh.wordpress.com/2017/03/18/33-nowe-zrodla-genetyczne-czyli-czy-to-smierc-teorii-o-10000-lat-bytnosci-r1a-w-anatolii-na-balkanach-puszcie-i-pochodzeniu-szlachty-polskiej-od-sarmatow-itp/#comment-388
https://skrbh.wordpress.com/2017/03/21/34-polnocna-droga-r1a-czyli-min-koniec-bredni-o-tzw-starozytnosci-jezyka-litewskiego-pochodzeniu-tzw-scytow-tocharow-itd/#comment-392
(…) Co mają „N” do starożytności języka litewskiego i innych bałtyjskich? Z tego co skumałam z wypowiedzi zajmujących się genetyką userów korespondujących ze Sławomirem, uważa się starożytne języki bałtyjskie za wypowiadane przez R1a (Z280 albo jakąś jej część). Więc pewnie i kultury z tą hg związane uważają za bałtyjskie. Wyraźnie w każdym razie promują Bałtów. (…)
Nie ma N, nie ma ugro-fińskiego podkładu językowego, nie ma języków bałtyckich,.. które powstały na bazie bardzo późnej nakładki językowej ugro-fińskiej, która nałożyła się na Pra-Słowiański podkład językowy, wywodzący się nie z Yamnaya i Skałkazu,.. ale Karelii (laso-step, łowcy EHG R1a)… hehehe
PolubieniePolubienie
Jakim krewnym był Karelczyk dla M417?
Należał do Y haplogroup R1a1-M459* and mitochondrial haplogroup C1g.
A R1a1 (M459)
R1a1a (M17)
R1a1a1 (M417)
Był jakimś krewnym.
Gościa się modeluje: 70% European 30% Amerindian, albo 75% Atlantic Baltic 25% Amerindian + Siberian + South Asian, albo 80% North European 20% Amerindian + Arctic, albo 84% Atlantic Baltic 16% Siberian + South Asian albo 50% West European 33% East European 17% Asian itd.
„100% R1a w Afanasiewo to Z93!!! Patrz na dane, które zamieściłem w tabelce, tu” Co to jest próbka Sag, bo tylko w niej są R1a?
“Czy to nie przeurocze?” Schizofreniczny gość? No nie wiem. Ale nie mam pojęcia o kogo chodzi. Myślałam, że o Kliosowa. Chyba jednak nie.
„Ok, a masz na to „stare” N jakieś źródła?” Zapytaj Roberta. To jego info, a ja mu ufam.
PolubieniePolubienie
Czyli co, jednak nie był M420? Masz jakieś namiary na dane o nim?
(…) „Ok, a masz na to „stare” N jakieś źródła?” Zapytaj Roberta. To jego info, a ja mu ufam.”(…)
Ja tylko powtórzę, że między tym „starym” N1 nawet i sprzed 2800 lat to do Karelczyka, czy nawet tych różnych R1a z Narva no to mamy od… 2000, do 4700 lat różnicy… Ktoś uważa jeszcze, że w języku litewskim, a także i germańskim podkładem językowym był „stary” paleo-proto-ugro-qurfa-jakiś-wirtualny-fiński, hm? 🙂
Jaska to chyba teraz ma zdrowo przejebane na forumbiodiversity, a jak jeszcze nie ma, no to zaraz będzie miał… Pamiętacie jeszcze o „leniwych Finach i aktywnych Słowianach”, co to tym pierwszym pług pokazali? Fińscy jęsykosnaftzy to taka uboga wylizująca germańskiego rowa europejska hindutva, co to niby miała odnaleźć ugro-fiński podkład językowy w j. słowiańskim także, który to ugro-fiński podkład niby miał być także podkładem językowym dla tych „odwiecznych i czystej krfi”, że to niby „odwiecznie starzy Finowie”, byli wszędzie w Europie… już od barfo dafna… patrz:
Ci no to miszczofie litefktzy som… Lubię ich za odwagę za ten zbałyzowany pra-albański, jako słowiański. Nawet Curta wg mnie nie dorasta im do pięt z jego „lingua franca kaganatu awarskiego”, choć tez jest jednym z moich najulubieńszych oblubieńcóf, jak np. Jagodziński z jego „italsko-wenetyjskim” podkładem językowym w j. słowiańskim…
http://www.lituanus.org/1991_4/91_4_08.htm
THE ORIGINS OF PRE-BALTIC
(…)As for later similarities between Baltic and Slavic, we can say the following. Essentially, Slavic is a sort of Albanian heavily influenced by Baltic from the time when Pre-Slavs migrated north into Pre-Baltic territory from the Carpathians while Pre-Albanians were migrating south from there to the Balkans. Since these Baltic and Slavic contacts showed linguistic influences that were not entirely one-sided, one could speak of a sort of new „Balto-Slavic” languages-in-contact amalgam faintly reminiscent of the ancient Pre-Baltic dialects-in-contact amalgam. But the Pre-Baltic one showed sharing of some unique purely phonologically based innovations with phonological and morphological consequences.20 The later „Balto-Slavic” one shows at most the morphologically-syntactically based innovation of „Balto-Slavic” accentuation.12 Therefore, Slavic today is merely a sort of Balticized Albanian. (…)
Kliknij, aby uzyskać dostęp FA11_104.pdf
„ACTIVE SLAVS” AND „PASSIVE FINNS”:A REPLY
https://sucs.org/~pwb/misc/sample.txt
The „Urheimat” of Proto-Finno-Ugric, the hypothetical proto-language of the modern Finno-Ugric languages, cannot be located with any certainty.(…)
Wszystko dostępne od dawna w Źródłach / Językoznawstwo… 🙂 Ileż ja się tego przeciw-słowiańskiego jęsykofeko gófna naczytałem… a teraz będę mścił się, za mój zmarnowany czas… hehehe
PolubieniePolubienie
„Czyli co, jednak nie był M420? Masz jakieś namiary na dane o nim?” Był, bo M420 to R1a.
R1a (M420)
R1a1 (M459) Tu się łapie Karelczyk
R1a1a (M17)
R1a1a1 (M417) A to się rozmnożyło podczas Corded Ware
Czyli dla M417 Karelczyk mógł być dziadkiem albo jednym z dziadka braci.
Napisałam ci o północy jak się go modeluje. Spójrz też na mtDna C1. Jak byś go etnicznie widział?
PolubieniePolubienie
Czyli Pra-Słowianin, łowca z Karelii, w dzisiejszej Rosji, pogrzebany na wyspie Olenij Ostrow na jeziorze Onega… nie był R1a M420, a był R1a1 (M459)…
Masz na te dane jakieś źródła? Zamieść je tu proszę, bo to jest ogromnie ważne!
http://eng.molgen.org/viewtopic.php?f=77&t=1722
Question about R1a1/M459*
http://www.forumbiodiversity.com/showthread.php/47575-R1a1-M459-(with-U4)-and-I2a2a-M223-(with-U5b2)-in-prehistoric-Ukraine
R1a1 M459 (with U4) and I2a2a M223 (with U5b2) in prehistoric Ukraine
Litvin 2017-02-04, 11:37 #1
Default R1a1 M459 (with U4) and I2a2a M223 (with U5b2) in prehistoric Ukraine
SNP calls:
https://genetiker.wordpress.com/2017/02/04/y-snp-calls-from-mesolithic-and-neolithic-latvia-and-ukraine/
Ukraine_HG1 (Vasilyevka, age 11143-10591 ybp) = I2a2a-M223, mtDNA U5b2
Ukraine_N1 (Vovnigi, age 6469-6293 years ago) = R1a1-M459*, mtDNA U4
Ukraine_N1 with R1a1 was part of the Dnieper-Donets culture:
https://en.wikipedia.org/wiki/Dnieper%E2%80%93Donets_culture
Another I2a2a was also found much later in Catacomb culture.
Litvin 2017-02-04, 18:58 #2
Default
This is where 9 out of 13 of the oldest samples of R1a and R1b have been found:
The „core” territory of R1a and R1b people >6000 years ago:
List of nine samples from the map:
1) Karelia, ca. 8850-8000 (avg. 8425) years ago – R1a
2) Latvia, ca. 7800-7600 (avg. 7700) years ago – R1b
3) Samara, ca. 7650-7560 (avg. 7605) years ago – R1b
4) Latvia, ca. 7250-6800 (avg. 7025) years ago – R1b
5) Khvalynsk, ca. 7200-6000 (avg. 6600) years ago – R1b
6) Khvalynsk, ca. 7200-6000 (avg. 6600) years ago – R1a
7) Ukraine, ca. 6470-6290 (avg. 6380) years ago – R1a
8) Latvia, ca. 6200-5930 (avg. 6065) years ago – R1b
9) Smolensk, around 6000 (avg. 6000) years ago – R1a
https://genetiker.wordpress.com/2017/02/04/y-snp-calls-from-mesolithic-and-neolithic-latvia-and-ukraine/
Y-SNP calls from Mesolithic and Neolithic Latvia and Ukraine
Posted on February 4, 2017 by Genetiker
In the table below are links to Y-SNP calls for samples from Mesolithic and Neolithic Latvia and Ukraine.
Sample Culture Date BC Haplogroup
Latvia_HG2 Narva 5841–5636 pre-R1b1a1a1-M73
Latvia_HG3 Early Neolithic 5302–4852 pre-R1b1a1a1-M73
Latvia_MN1 Middle Neolithic 4251–3976 R1b1a1a-P297
Ukraine_HG1 Mesolithic 9193–8641 I2a2a-M223
Ukraine_N1 Dnieper-Donets 4519–4343 R1a1-M459*
PolubieniePolubienie
Sorry, zapomniałam, że tam była gwiazdka. R1a1-M459* a nie R1a1-M459. Więc usuń „Tu się łapie karelczyk” przy R1a1 (M459)
https://en.wikipedia.org/wiki/Paragroup
Prawdopodobnie te dane były tu http://biorxiv.org/content/early/2015/02/10/013433
Ja to rozumiem, ze Karelczyk był wnukiem R1a (M420), więc musiał po dziadku też być dodatni na M420, ale jego geny dalej mutowały. Drugim wnukiem M420 był M17, którego syn to M417. czyli Karelczyk jest stryjem M417.
Poproś Roberta, żeby tu zajrzał i poprawił, jeśli cos poplątałam.
PolubieniePolubienie
Robert z reguły nie robi nic, o co go proszę, więc sami musimy to sprawdzić…
PolubieniePolubienie
Skribho, nie mam czasu sprawdzac. Jeśli wszyscy podają R1a1-M459* albo PF6235 to sprawdź sobie na drzewku w Wiki i sam oceń jak się ma i do czego.
Nie ma tu danych? http://biorxiv.org/content/early/2015/02/10/013433 Powinny być.
Robert jest w porządku. A mi nie chodziło o hg Karelczyka, tylko o paragrupę. Czy to dobrze jarze. No wiesz o te gwiazdki. Po mojemu to niesklasyfikowany potomek. A Robert (jak zechce) to wyjaśni czy myślę ok.
A poza tym, ja nadal nie wiem skąd M417 się wzięło. I jak załapało się na 25% rolników, jeśli jego starsi kuzyni byli łowcami.
PolubieniePolubienie
Zmutowało może pod wpływem hodowli krów i zaczęciu trawienia mleka? Co do gwiazdek nic o tym nie wiem. Będę drążył to, ale im więcej czytam co Haak napisał, to se myślę, że to celowo żeby zaciemnić, że R1a to łowcy, a dopiero później hodowcy…
Zapytałem Dragomiry o potwierdzenie czegokolwiek na temat 10,000 R1a na Bałkanach,.. i nadal czekam choćby na jedno źródło. Pewno w sobotę albo w niedzielę złoże wpis o Z93, Kliosowie, schizofrenicznych pieprzeniach i językach pra-irańskich, bo pewno było ich kilka, jako ze to jest przykład na zniekształcenia powstałe nie jak sądziłem 3500 lat temu, a 5600…
A… Też od dawna uważam, że Robert (jeden z kilku Robertów) jest w porządku, ale jak każdy z nas ma swoje narowy. On z zasady olewa szukanie czegoś dla mnie, ale wrzuca co sam znajduje… Jest bardzo pomocny i udowodnił już, że rozumie co w trawie piszczy a no i nie odpuszcza zawsze, bo z rudaweb pokazał im że nie kumaja czaczy, tylko ślizgają się po powierzchni problemów genetycznych, językowych i logicznych. To historycy i to wszystko wyjaśnia… hehehe
A no i Ty oczywiście jesteś niezła w te klocki i rozsądnie uparta… Tak trzymaj i nigdy na mnie nie obrażaj się, bo ja tak już mam, że raczej lubię rozmawiać prawdziwie i na chropowato, niż na delikatnie przez bibułkę…
PolubieniePolubienie
Jak to, jestem uparta? O co ci znowu chodzi? Czy ja ci wypominam, że jesteś dość często protekcjonalny? Jestes jaki jesteś i już. Kiedyś wspomniałam, że nie widzę szansy na zmianę narracji, bo konserwa od Gustafa ma wiele lat pracy całych zespołow naukowców a talże odpowiednie środki i obecni wyznawcy muszą jedynie manipulować nowymi danymi. Żaden amator tego nie przeskoczy. Tym bardziej, że wśród tych ostatnich są nie tylko ideolodzy ale i sporo maruderów próbujących „odkryć prawdę”. A to zajęcie o wiele trudniejsze i zawsze obarczone błędem. Dlatego szanuję wszystkich domorosłych „odkrywców”, niezależnie od obranych metod, mniej czy wiecej naukowych ani ich inteligencji, czy naiwnych wniosków. I nie podoba mi się wzajemne kopanie po kostkach, gdy przeciwnikiem na tym meczu jest zupełnie ktoś inny i nie jest to banda przebierańców z 3 ligi.
PolubieniePolubienie
Jesteś uparta, bo nie odpuszczasz i masz własne zdanie, to KOMPLEMENT!!! 🙂
Przy okazji patrz na to:
https://skrbh.wordpress.com/2017/03/26/36-odpowiedz-lowcom-ruskich-trolli-czyli-dlaczego-twierdzenie-o-10-000-latach-bytnosci-r1a-na-balkanach-to-jak-dotad-niczym-nie-potwierdzona-tylko-czysta-fantazja-01/
I co Ty na to,.. hm? 🙂
PolubieniePolubienie
„Nie obrażaj się”
Oczywiście, że nie.
Nie będę pisać o języku, bo jestem w tej dziedzinie dosyć zielona i nie wyczuwam co jest głupie bądź naiwne a co nie pasuje do twojej koncepcji.
Ale skoro zauważyłeś że jestem uparta, to wkleję co napisałam 2 tygodnie temu, ale nie opublikowałam z powodu jak powyżej.
„Nie wiem dlaczego cyfra rzymska „C” mnie zainteresowała i dlaczego oznacza ona 100. I fakt, myślałam że tak jak Anglicy wymawiają jak „k” albo „si” to Grecy też coś wymodzili.
K – κάππα (wym. kappa), wymowa [c] przed [e̞] lub [i]; w innych wypadkach [k]
kat >> cięty, rękojmia >> poręczenie”
PolubieniePolubienie
Uważam, że tak jak znak K w „łacińskim” kalendae, tak i C… są pozostałościami po wymowie Pra-Słowiańskich dźwięków, których ci kreole zwyczajnie nie umieli wypowiedzieć…
https://en.wiktionary.org/wiki/kalendae
Latin
Alternative forms
Etymology
From Proto-Indo-European root *kelh₁- (“to call, summon”).
Pronunciation
Noun
kalendae f pl (genitive kalendārum); first declension
Declension
First declension.
Related terms
Descendants
See also
References
https://en.wiktionary.org/wiki/Reconstruction:Proto-Indo-European/kelh%E2%82%81-
Proto-Indo-European
Root
*kelh₁-[1][2]
Derived terms
References
PolubieniePolubienie
PRA-SŁOWIANIE BYLI ŁOWCAMI. TU JEST WSZYSTKO NAPISANE,.. NO MOŻE POMINĘLI KARELCZYKA I JEGO R1a M417 lub M420,.. i to, że YAMNAYA OD NIEGO POCHODZI!!! 🙂
Nawet eupedia jest po mojej stronie… hehehe
http://www.eupedia.com/europe/Haplogroup_R1a_Y-DNA.shtml
Paleolithic mammoth hunters
Haplogroup R* originated in North Asia just before the Last Glacial Maximum (26,500-19,000 years before present). This haplogroup has been identified in the 24,000 year-old remains of the so-called „Mal’ta boy” from the Altai region, in south-central Siberia (Raghavan et al. 2013). This individual belonged to a tribe of mammoth hunters that may have roamed across Siberia and parts of Europe during the Paleolithic. Autosomally this Paleolithic population appears to have contributed mostly to the ancestry of modern Europeans and South Asians, the two regions where haplogroup R also happens to be the most common nowadays (R1b in Western Europe, R1a in Eastern Europe, Central and South Asia, and R2 in South Asia).
Haplogroup R1a probably branched off from R1* during or soon after the Last Glacial Maxium. Little is know for certain about its place of origin. Some think it might have originated in the Balkans or around Pakistan and Northwest India, due to the greater genetic diversity found in these regions. The diversity can be explained by other factors though. The Balkans have been subject to 5000 years of migrations from the Eurasian Steppes, each bringing new varieties of R1a. South Asia has had a much bigger population than any other parts of the world (occasionally equalled by China) for at least 10,000 years, and larger population bring about more genetic diversity. The most likely place of origin of R1a is Central Asia or southern Russia/Siberia.
From there, R1a could have migrated directly to eastern Europe (European Russia, Ukraine, Belarus), or first southward through Central Asia and Iran. In that latter scenario, R1a would have crossed the Caucasus during the Neolithic, alongside R1b, to colonise the Pontic-Caspian Steppe. In the absence of ancient Y-DNA from those regions the best evidence supporting a Late Paleolithic migration to Iran is the presence of very old subclades of R1a (like M420) in the region, notably in the Zagros mountains. However these samples only make up a fraction of all R1a in the region and could just as well represent the descendants of Eastern European hunter-gatherers who branched off from other R1a tribes and crossed from the North Caucasus any time between 20,000 and 8,000 years ago. The logic behind this is that most known historical migrations in Eurasia took place from north to south, as people sought warmer climes. The only exception happened during the Holocene warming up of the climate, which corresponds to the Neolithic colonisation of Europe from the Near East. A third possibility is that R1a tribes split in two around Kazakhstan during the Late Paleolithic, with one group moving to eastern Europe, while the other moved south to Iran.
Did R1a come to Europe with Neolithic farmers ?
Some people have theorized that R1a was one of the lineages of the Neolithic farmers, and would have entered Europe through Anatolia, then spread across the Balkans toward Central Europe, then only to Eastern Europe. There are many issues with this scenario. The first is that 99% of modern R1a descends from R1a1a (M417), a subclade that clearly expanded from the Bronze Age onwards, not from the early Neolithic. Its phylogeny also points at an Eastern European origin. Secondly, most of the R1a in Middle East are deep subclades of the R1a-Z93 branch, which originated in Russia (see below). It could not have been ancestral to Balkanic or Central European R1a. Thirdly, there is a very strong correlation between the Northeast European autosomal admixture and R1a populations, and this component is missing from the genome of all European Neolithic farmers tested to date – even from Ötzi, who was a Chalcolithic farmer. This admixture is also missing from modern Sardinians, who are mostly descended from Neolithic farmers. This is incotrovertible evidence that R1a did not come to Europe with Neolithic farmers.
Bronze Age Proto-Indo-Europeans
R1a is thought to have been the dominant haplogroup among the northern and eastern Proto-Indo-European language speakers, that evolved into the Indo-Iranian, Thracian, Baltic and Slavic branches. The Proto-Indo-Europeans originated in the Yamna culture (3300-2500 BCE). Their dramatic expansion was possible thanks to an early adoption of bronze weapons and the domestication of the horse in the Eurasian steppes (circa 4000-3500 BCE). The southern Steppe culture is believed to have carried predominantly R1b (M269 and M73) lineages, while the northern forest-steppe culture would have been essentially R1a-dominant. The first expansion of the forest-steppe people occured with the Corded Ware Culture (see Germanic branch below). The migration of the R1b people to central and Western Europe left a vacuum for R1a people in the southern steppe around the time of the Catacomb culture (2800-2200 BCE). The forest-steppe origin of this culture is obvious from the introduction of corded pottery and the abundant use of polished battle axes, the two most prominent features of the Corded Ware culture. This is also probably when the satemisation process of the Indo-European languages began since the Balto-Slavic and Indo-Iranian language groups belong to the same Satem isogloss and both appear to have evolved from the the Catacomb culture.
Ancient DNA testing has confirmed the presence of haplogroup R1a1a in samples from the Corded Ware culture in Germany (2600 BCE), from Tocharian mummies (2000 BCE) in Northwest China, from Kurgan burials (circa 1600 BCE) from the Andronovo culture in southern Russia and southern Siberia, as well as from a variety of Iron-age sites from Russia, Siberia, Mongolia and Central Asia.
PolubieniePolubienie
Tu podaje namiary na dane o Karelczyku R1a1 M459:
http://dienekes.blogspot.co.uk/2015/02/a-story-of-69-ancient-europeans.html
A new study on the bioRxiv includes data on 69 ancient Europeans (remember when we got excited in anticipation for the single genome of the Iceman? that was only three years ago) and adds plenty of new info to chew on for those of us interested in prehistory.
Two Near Eastern migrations into Europe
In 2011, I observed that West Eurasian populations were too close (measured by Fst) to allow for long periods of differentiation between them. By implication, there must have been a „common source” of ancestry uniting them, which I placed in a „womb of nations” of the Neolithic Near East. I proposed that migrations out of this core area homogenized West Eurasians, writing:
The new paper confirms the last two of these migrations. The remainder involve parts of the world from which no ancient DNA has been studied.
The first migration (early Neolithic) is already uncontroversial, but the paper includes data from Spanish early farmers that are also Sardinian- and LBK-like. The „Sardinian” Iceman was no fluke. It is now proven that not only the LBK but also the Spanish Neolithic came from the same expansion of Mediterranean populations which survives in Sardinia. The authors write:
The second migration went into eastern Europe:
The EHG (Eastern European Hunter-Gatherers) are likely Proto-Europeoid foragers and the Yamnaya (a Bronze Age Kurgan culture) were a mixture of the EHG and something akin to Armenians.The „attraction” of later groups to the Near East is clear in the PCA: hunter-gatherers on the left side, the Near East (as grey dots) on the right side, and Neolithic/Bronze Age/modern Europeans in the middle. The second migration may very well be related to the Uruk expansion and the presence of gracile Mediterranoids and robust Proto-Europeoids in the Yamna:
The authors present a table of Fst values which confirms the homogenizing influence of migrations from the Near East. The WHG group has an Fst=0.086 with Armenians, but the LBK farmers have only 0.023. The EHG group has an Fst=0.067 with Armenians, but the Yamnaya steppe people have only 0.030. Someone might argue that it is the Armenians that are receiving genes from Europe, but the same pattern holds even for the Bedouins, for which admixture with Europeans seems far-fetched: 0.106 to 0.043 and 0.093 to 0.060. It is now clear that the „glue” that did not allow West Eurasian populations to drift very far apart were migrations from the Near East.
The (partial) demise of the farmers
It seems that the legacy of the early farmers suffered two hits, which is why only in Sardinia and (to a lesser degree) in southern Europe that they have persisted as the major component of ancestry. The first blow came during the Neolithic:
And the coup de grâce after the 5kya mark:
Confirmation of the Bronze Age Indo-European invasion of Europe
In 2012 I had used the paltry data on a handful ancient DNA samples to observe that in ADMIXTURE modern Europeans had a West Asian genetic component (peaking in „Caucasus” and „Gedrosia”) that pre-5kya Europeans didn’t. I proposed that the Bronze Age migration of the Indo-Europeans spread this component:
This prediction is now confirmed:
I was a little puzzled with the „Ancient North Eurasians” recently proposed as a „third ancestral population” for Europeans: it seemed to be a tertium quid that spread after 5kya, but very different geographically than the „West Asian” component. But:
So, it seems that there is no contradiction after all and both EHG (which is related to „Ancient North Eurasians”) and another type of Near Eastern ancestry (=West_Asian) arrived after 5kya.
1939 strikes back
It is amazing how well this was anticipated by Carleton Coon in 1939. Back then much of West Eurasia was an archaeological/anthropological terra incognita, there was no radiocarbon dating, no DNA, no computers, not even serious multivariate statistics. And yet:
And in 2015:
In 1939:
In 2015:
The EHG is still flimsy as it’s only two individuals from Karelia and Samara who are very similar to each other. It’s hard not to imagine that the hunter-gatherer from Russian Karelia (outside any proposed PIE homeland) would be speaking a similar language as his Samara counterpart. Did they both speak „element A” and was PIE formed when the „southern” steppe hunter-gatherers came into contact with „element B” people from the Caucasus? Short of a time machine, we can never say for sure. This might very well be an answer to the conundrum of Uralic/Proto-Kartvelian borrowings. There is simply no geographical locale in which these two language families neighbor each other: Northwest, Northeast Caucasian speakers and the pesky Greater Caucasus intervene. But, maybe there was no such locale, and these borrowings aren’t due to some „PIE people” living adjacent to Uralic and Proto-Karvelian speakers but the „PIE people” being a mix of an element A (EHG) that was (or interacted with) Uralic and another element B (Armenian-like) that was (or interacted with) Proto-Kartvelian.
Urheimat (or not?)
The authors of the current paper are agnostic about the PIE homeland:
Whatever the ultimate answer will be, it seems that Coon was right that „The unity of the original ” Indo- Europeans,” could not have been of long duration, if it was ever complete.” If PIE=EHG (as Anthony and Ringe suggest), then „from the crib”, PIE got half its ancestry from a non-IE, Near Eastern source. Conversely, if PIE=Near East (as I suggested) then „from the crib”, PIE got half of its ancestry from a non-IE, Eastern European source. The „Yamnaya” seems to max out in Norwegians at around half, which means that they are about a quarter Proto-Indo-European genetically, regardless of which theory is right.
These two possibilities (as well as the third one of PIE being neither-nor, but rather a linguistic mixture of the languages of the EHG and Near East) are testable. The Anthony/Ringe version of the steppe hypothesis predicts pre-Yamnaya expansions from the steppe. Whether these happened and what was their makeup can be tested: if they did occur and they did lack „Near Eastern” ancestry, then the steppe hypothesis will be proven. PIE in the Near East, on the other hand, predicts that some PIE languages (certainly the Anatolian ones) will be a „within the Near East” expansion. If such migrations did occur and they lacked „EHG” ancestry, then some variant of the Gamkrelidze/Ivanov model will be proven. Or, the truth might be that everywhere where Indo-Europeans arrive they carry a blend of „West Asian” and „EHG”, supporting the third possibility. Time will tell.
In the interim, I am curious about how much Yamnaya ancestry existed in different parts of Europe (all of the post-5kya samples in this study come from Germany, with a couple from Hungary). In northern Europe, all populations seem to have less Yamnaya ancestry than the Corded Ware: there it must have declined. But, modern Hungarians have more than Bronze Age Hungarians: there it must have increased.
Germany and a slice of Hungary is a very narrow window through which to see the whole of Europe and these results must be tested by looking at samples from beyond the „heartland”. I do hope that some kind of Moore’s law operates in the world of ancient DNA, and in three more years we’ll be reading studies about thousands of ancient individuals.
bioRxiv doi: http://dx.doi.org/10.1101/013433
Massive migration from the steppe is a source for Indo-European languages in Europe
Wolfgang Haak , Iosif Lazaridis , Nick Patterson , Nadin Rohland , Swapan Mallick , Bastien Llamas , GuidoBrandt , Susanne Nordenfelt , Eadaoin Harney , Kristin Stewardson , Qiaomei Fu , Alissa Mittnik , Eszter Banffy ,Christos Economou , Michael Francken , Susanne Friederich , Rafael Garrido Pena , Fredrik Hallgren , ValeryKhartanovich , Aleksandr Khokhlov , Michael Kunst , Pavel Kuznetsov , Harald Meller , Oleg Mochalov ,Vayacheslav Moiseyev , Nicole Nicklisch , Sandra L. Pichler , Roberto Risch , Manuel A. Rojo Guerra , ChristinaRoth , Anna Szecsenyi-Nagy , Joachim Wahl , Matthias Meyer , Johannes Krause , Dorcas Brown , DavidAnthony , Alan Cooper , Kurt Werner Alt , David Reich
We generated genome-wide data from 69 Europeans who lived between 8,000-3,000 years ago by enriching ancient DNA libraries for a target set of almost four hundred thousand polymorphisms. Enrichment of these positions decreases the sequencing required for genome-wide ancient DNA analysis by a median of around 250-fold, allowing us to study an order of magnitude more individuals than previous studies and to obtain new insights about the past. We show that the populations of western and far eastern Europe followed opposite trajectories between 8,000-5,000 years ago. At the beginning of the Neolithic period in Europe, ~8,000-7,000 years ago, closely related groups of early farmers appeared in Germany, Hungary, and Spain, different from indigenous hunter-gatherers, whereas Russia was inhabited by a distinctive population of hunter-gatherers with high affinity to a ~24,000 year old Siberian6. By ~6,000-5,000 years ago, a resurgence of hunter-gatherer ancestry had occurred throughout much of Europe, but in Russia, the Yamnaya steppe herders of this time were descended not only from the preceding eastern European hunter-gatherers, but from a population of Near Eastern ancestry. Western and Eastern Europe came into contact ~4,500 years ago, as the Late Neolithic Corded Ware people from Germany traced ~3/4 of their ancestry to the Yamnaya, documenting a massive migration into the heartland of Europe from its eastern periphery. This steppe ancestry persisted in all sampled central Europeans until at least ~3,000 years ago, and is ubiquitous in present-day Europeans. These results provide support for the theory of a steppe origin of at least some of the Indo-European languages of Europe.
Link
PolubieniePolubienie
Oryginał:
http://biorxiv.org/content/early/2015/02/10/013433
Massive migration from the steppe is a source for Indo-European languages in Europe
Wolfgang Haak, Iosif Lazaridis, Nick Patterson, Nadin Rohland, Swapan Mallick, Bastien Llamas, Guido Brandt, Susanne Nordenfelt, Eadaoin Harney, Kristin Stewardson, Qiaomei Fu, Alissa Mittnik, Eszter Bánffy, Christos Economou, Michael Francken, Susanne Friederich, Rafael Garrido Pena, Fredrik Hallgren, Valery Khartanovich, Aleksandr Khokhlov, Michael Kunst, Pavel Kuznetsov, Harald Meller, Oleg Mochalov, Vayacheslav Moiseyev, Nicole Nicklisch, Sandra L. Pichler, Roberto Risch, Manuel A. Rojo Guerra, Christina Roth, Anna Szécsényi-Nagy, Joachim Wahl, Matthias Meyer, Johannes Krause, Dorcas Brown, David Anthony, Alan Cooper, Kurt Werner Alt, David Reich
doi: https://doi.org/10.1101/013433
Now published in Nature doi: 10.1038/nature14317
Abstract
We generated genome-wide data from 69 Europeans who lived between 8,000-3,000 years ago by enriching ancient DNA libraries for a target set of almost four hundred thousand polymorphisms. Enrichment of these positions decreases the sequencing required for genome-wide ancient DNA analysis by a median of around 250-fold, allowing us to study an order of magnitude more individuals than previous studies and to obtain new insights about the past. We show that the populations of western and far eastern Europe followed opposite trajectories between 8,000-5,000 years ago. At the beginning of the Neolithic period in Europe, ~8,000-7,000 years ago, closely related groups of early farmers appeared in Germany, Hungary, and Spain, different from indigenous hunter-gatherers, whereas Russia was inhabited by a distinctive population of hunter-gatherers with high affinity to a ~24,000 year old Siberian6. By ~6,000-5,000 years ago, a resurgence of hunter-gatherer ancestry had occurred throughout much of Europe, but in Russia, the Yamnaya steppe herders of this time were descended not only from the preceding eastern European hunter-gatherers, but from a population of Near Eastern ancestry. Western and Eastern Europe came into contact ~4,500 years ago, as the Late Neolithic Corded Ware people from Germany traced ~3/4 of their ancestry to the Yamnaya, documenting a massive migration into the heartland of Europe from its eastern periphery. This steppe ancestry persisted in all sampled central Europeans until at least ~3,000 years ago, and is ubiquitous in present-day Europeans. These results provide support for the theory of a steppe origin of at least some of the Indo-European languages of Europe.
…..
UWAGA!!!
Uważam, że Haak KŁAMIE, bo Karelczyk był Przodkiem dla rzekomo „pra-indo-europejskiego” Yamnaya… więc był PPIE!!!
Uważam, że on, jak i „łowcy ruskich trolli” zwyczajnie próbują UKRYĆ PRAWDĘ O PRA-SŁOWIANACH I ICH JĘZYKU I DZIEDZICTWIE!!! 😦
PolubieniePolubienie
A przy okazji to wspiera mój pomysł, że tzw. skałkazki podkład językowy, rzekomo odnajdywany w tzw. języku PIE, czyli Pra-Słowiańskim (PS), patrz Bomhard, to jest w rzeczywistości skutek jedynie zapożyczeń Od-Pra-Słowiańskich, patrz KoL”o, Ko”L”+Ko -> K/GiL+K/GaL… Skałkaz i na jego południe…
Rzekomy podkład ugro-fiński właśnie utłukłem, a z nim i Jaskę i Kroonena, i resztę za nimi, bo mało było tego N1 np. 8000-3000 lat temu w Europie, nieprawdaż… 🙂
Pomyślcie:
Łowcy EHG R1a M459, np. za zwierzyną ze wschodu i północy dotarli na granicy laso-stpepu nad Jezioro Czarne, gdzie zmieszali się z (R1b, I1/2..?) Na stepie zmutowali np. w M420 i udomowili konia, wynaleźli koło, wóz, itd.. Dalej już zmieszani i zmutowani dotarli nawet dalej na Skałkaz (R1b, G, H, J, I..?)…zabrali sobie stamtąd „armeńskie” żony ANE?, z nimi zmajstrowali R1a Z93, które poszło na wschód z R1b nad Załtaj Afanasiewo,.. a na zachodzie i północy powrócili do swoich Dziadów Łowców LICZNIE I Z LICZNYMI nowymi wynalazkami…
Pytanie o zaczęcie hodowli, osiadły tryb życia, i sery… z Kujaw pozostawiam otwarte… 🙂
PolubieniePolubienie
Na historykach fragment wpisu WojciechaS:
„Do niedawna byłem przekonany, że Z645 to marker indobałtosłowiański, a Z93 to marker indoirański.
Ale naukowcy twierdzą, że ludność Azji Pd. nie wywodzi sie z kultur Sintaszta i Andronowo lecz z kultur wcześniejszych, jak grobów jamowych:
https://twitter.com/iosif_lazaridis/status/…675908156772353”
Nie uważasz, ze to interesujące? Coś, jakby geny Pd. Azjaci dostali z 1) Iranu 2) ze stepu jak Yamna z R1b a nie jak Andronowo z R1a.
Pomyśl, może ten bloger, którego nazywasz Hindutva miał rację? I Z93 przybyło tam z Iranu, a nie ze stepu. Bo już na pewno wiemy że nie z Sintaszta i Andronowo.
Poza tym nie odpowiedziałeś mi na pytanie o R1a w Afanasjewo
„100% R1a w Afanasiewo to Z93!!! Patrz na dane, które zamieściłem w tabelce, tu” Co to jest próbka Sag, bo tylko w niej są R1a?
https://drive.google.com/file/d/0B9o3EYTdM8lQWWRud1dzYWQzUW8/view”
Te próbki Sag o które pytam nie są zmieszane z R1b tylko z Q. Ciekawe co to mógł być za odłam Afanasiewo? Wczesny, późny? Wiesz, do tej pory w ogóle nie wiedziałam, że były jakieś R1a w tej kulturze. Sądziłam, że to jedynie wschodnia migracja Yamna. Więc zastanawia mnie skąd R1a Z93 się tam wzięło.
PolubieniePolubienie
Sag to pewno skrót od nazwy miejsca i tyle… R1a Z93 wzięło się ze wschodniej Yanmaya, jako zmutowany „potomek” Karelczyka, patrz Afanasiewo, ale później zostali wyparcie przez kolesi z Andronowo, też „potomków” Karelczyka, ale nie Z93…
Nie ma dowodów, na jakiekolwiek migracje ludów z Płaskowyżu Irańskiego na step… Hindutva utrzymują, że R1a pochodzi z Harappa… itd,.. i to nie bloger, a nacjonaliści hinduscy… 🙂
Będę pisał o tym wpis, ale na koniec przyszłego tygodnia… R1a pochodzi z Syberii, z okolic Bajkału i Karelczyk to Pra-Słowianin… a Z93 z Yamnaya, to tylko kolejni mieszańcy, co zmieszani wrócili do domu, na północ od stepu…
Tak, czy srak, R1a pochodzi z Rosji i byli to Pra-Słowianie łowcy mamutów… i to dlatego „łowców ruskich trolli” łapie gul,.. bo może już w końcu i do nich dotarło,.. że to niestety (dla nich) prawda… hehehe
PolubieniePolubienie
Wiem, że to dla wielu wolnych umysłów straszne i straszliwie niezrozumiałe, ale lepiej zapoznać się z tymi danymi, jak i z komentarzami napisanymi tam, zwłaszcza te od Goga, który twierdzi, podobnie do mnie, że BYŁY DWIE FALE OSIEDLEŃCZE ZE „STEPU” (wg mnie z laso-stepu!).
Pierwsza „Karelczycy” z ich starym R1a (tym, czy tamtym), a potem druga, czyli już potomkowie ich ale zmieszani z „armeńskimi kobietami”, którzy przynieśli ze sobą hodowlę np. koni, i uprawę ziemi!!!
Zmieszali się na stepie nadczarnomorskim, rozmnożyli, bo mieli „nadwyżkę żywności”, bo nie musieli TYLKO POLOWAĆ… i „zalali” ziemie swoich „karelskich” Przodków… To wyjaśnia też BRAK PODKŁADU JĘZYKOWEGO W JĘZYKU SŁOWIAŃSKIM I ZAPOŻYCZENIA OD PRA-SŁOWIAŃSKIE (GiL+GaL / Ko”L”+Ko) W J. KARTWELSKICH I SEMICKICH!!!
„Karelczycy” wędrowali przez pustkę, pozostali w pustce, a potem tylko zalała ich ludność pochodna od R1a M417, ale nie R1b, bo ci „wyszli” ze stepu „tzw. droga południową R1b”, przez Skałkaz, Anatolię, Egipt, itd. Kamerun jest chyba znacznie starszy, więc byłaby to wcześniejsza fala R1b, patrz także Villbruna!!!
http://www.eupedia.com/forum/archive/index.php/t-32990.html
New map of Yamna admixture (Eurogenes Steppe K10)
Maciamo 18-10-16, 15:58
I finally found some time to make the map of Yamna admixture using the data from Eurogenes Steppe K10. There was no data for some countries, so I had to guess based on neighbouring countries or isolated samples reported on forums. That is the case for Portugal, Ireland, Wales, the Netherlands, Switzerland, Austria, Slovenia, Slovakia and Azerbaijan.
I would especially need regional samples from all over Iberia. There are huge variations from nearly 0% of Yamna among some Basques to 16% in some Spaniards (but their region of origin is unknown). The Eurogenes data just shows a lower percentage in northern Spain, but that is not very helpful as Galicia, Cantabria and Catalonia probably have very different levels.
Regional data from Britain, France and Germany are also welcome.
Even though Yamna chieftains from kurgan belonged almost exclusively to R1b, among modern Europeans it is the Uralic, Baltic, Slavic, Germanic and North Caucasian people who inherited the highest share of Yamna ancestry, not Western Europeans, who now have the highest percentage of haplogroup R1b. One of the reasons for this is that R1b arrived in Western Europe after over a thousand years of genetic dilution through intermarriages with Balkanic and Central European people. In contrast, in the eastern half of Europe, R1b lost its position of dominance and was replaced by R1a and N1c lineages, starting from the Catacomb culture in the Pontic-Caspian Steppe, and continuing until the Middle Ages. Nevertheless Yamna ancestry was passed maternally in the Steppe and in neighbouring populations, which explains the high Yamna admixture from the Baltic to the North Caucasus.
Maciamo19-10-16, 08:55
I disagree, imo it makes more sense that Basques got their ~80+ of R1b from 25% of their ancestry than just 0-5% of it. So much founder effect is just ridiculous. Not even in India is the aDNA of the R1a bearers so low.
No it doesn’t make sense because the Basque R1b-M153 is only 2800 years old and has a TMRCA of 2500 years. Most Basques belong to the subclade just under that, with a TMRCA of 2100 years. This means that the Basque R1b is a very recent phenomenon starting in Roman times. But who knows, R1b might have continued to expand little by little each generations among the Basques for over 1000 years before reaching today’s frequencies. I now believe that the Basque only got their R1b very gradually over the last 2500 years and that it has nothing to do with Bronze Age PIE invasions. That has the benefit to explain why they kept speaking Basque. I don’t know why R1b increased gradually. Maybe increased fertility compared to the native male lineages (I2-M26 + G2a ?), or a noble lineage of some sort. It was probably a combination of factors. Anywau, if R1b entered the Basque gene pool from, say, neighbouring Aquitaine or Castille c. 500 BCE or even 100 BCE, it could have been autosomally low in Yamna ancestry (say 15-20%). After diluting it slowly over 1000 to 2000 more years with relatively pure Basque women, there would be very little Yamna left, surely under 5%. If Haak et al. are right and the Basque have 27% of Yamna, then it becomes much harder to explain with such a young TMRCA for their R1b, especially that Haak found 5% less Yamna among other Spaniards (22%). Spanish branches of DF27 are between 3500 and 4400 years old, so Late Bronze Age, and match the arrival of foreign Bronze Age cultures like El Argar. So there is no doubt that R1b was in many parts of Spain long before it spread among the Basques.
It’s good that you mention India. Indian Brahmins have at most 15-20% of Steppe DNA. In fact, since they descend from Sintashta rather than Yamna, their Steppe DNA should be higher in EHG than CHG. Using Dodecad K12, they have about 18% of East European + West European + Mediterranean, but the latter also includes non-IE Neolithic ancestry. Using K12b, they have only 5% of Atlantic_Med + North European, but that doesn’t include the Gedrosian that came with the IE. So depending on the calculator, we get somewhere between 7 and 18% of Steppe admixture. Unfortunately neither the Haak paper nor the Steppe K10 data have any Indian sample. But the Indo-Aryans invaded India from 1800 BCE, almost exactly at the same time as IE invaded Iberia with El Argar. And we get a similar percentage of Steppe admixture (10-20%) both in Spaniards and upper-caste Indians. But it took another 1500 years before R1b-M153 started spreading among the Basques, so a considerably lower Steppe admixture is to be expected.
MarkoZ 19-10-16, 10:42
People with Baltic Hunter Gatherer genomes said they’re WHG. Before that I thought they’d be EHG admixed as well. The error lies in assuming that the Baltic populations are the result of a simple coalescence of Neolithic Corded Ware and Mesolithic elements. We already know that North-Eastern Europe received substantial input from further east by way of Russia, since N1c is the dominant paternal marker in all North-Eastern populations barring Belarusians. The preponderance of this marker transcends linguistic and national affiliation.
Olympus Mons
19-10-16, 11:53
Finally! 🙂 I’ve been saying this since Haak et al came out, but so far no one has seen that possibility. I said then that maybe the title of the paper „Massive Migration from the steppe”, was incorrect.
If there was a large reservoir of SHG (which was an admixture, supposedly, of WHG and the EHG) in the north, or maybe other groups we haven’t yet sampled, or EHG further west elsewhere, wouldn’t that inflate the „Yamnaya” percentages beyond what actual Yamnaya people brought who moved there?
YES. What I don’t get it is why every time I raise those options I get immediately eviscerated by ten guys (especially at eurogenes!).
Maybe you Angela can enlighten me a little bit.
If Karelia was EHG (and already R1a). If there is SHG which is a mix of EHG and WHG, if apparently there is even EHG and SHG in the Balkans 7000bc… why in hell people insistently talk about a bunch of guys that show up near the freaking urals, as a uber event in Europes ancestry?
Also how do we know that CWC = massive Yamnya migration (sort of) if the region where they thrived might have been loaded up with EHG and even guys that were R1a?
Tomenable 19-10-16, 14:04
so how do we know that CWC = massive Yamnya migration (sort of) if the region where they thrived might have been loaded up with EHG and even guys that were R1a?
Kunda and Narva cultures = no any R1a and no any EHG, 100% WHG and their Y-DNA was haplogroup I. Today areas formerly occupied by Kunda and Narva cultures are dominated by R1a and N1c haplogroups.
Goga 19-10-16, 18:48
But the map I made was only for the ‚Steppe’ component, Then you should rename it into the ‚map of Steppe admixture’. Since it doesn’t correspondent well with the ‚Yamnaya admixture’. At this moment your map is MISLEADING and full of contradictions. Like now according to your map there is more Yamnaya admixture in Finno-Ugric/Saami people than European Indo-Europeans. Like you said Yamnaya Admixture is more than Steppe Admixture.
Steppe admixture in NorthEastern Europe existed even before the arrival of late second stage Yamnaya PIE. So, a lot Steppe ancestry in NorthEastern Europe has nothing to do with second stage Proto-Indo-European speakers from Yamnaya.
Yamnaya = Steppe + NorthWest Asia.
So, you should rename your map into ‚map of Steppe admixture’ or change your percentages about the Yamnaya ancestry.
Goga19-10-16, 19:04
I knew N1c couldn’t be a Baltic hunter gatherer. N1c, Siberian admixture, and Uralic languages in Northeast Europe all probably have the same post-CWC source. Then again its arrival might be different for different regions.I started to think that to, before I realized that this map is WRONG on many levels. After seeing his map I started to believe that Saami have more Corded Ware admixture than Norwegians, lol. But I was mislead by a wrong map. It was stupid of me, not to make additional examination of data.
So, hold on a minute. The map of Maciamo doesn’t hold any ground and is at least misleading. I don’t think Maciamo tried to mislead us on purpose. He is still making mistakes by using sources from people with hidden twisted agenda.
His map is not about Yamnaya but the Steppes. And there IS a correlation between the Steppes admixture AND Y-DNA hg. like N1c1 & Q.
Goga19-10-16, 19:14
Absolutely crazy, no way to deal with it, if I have understood well Gedrosia was the actual Chalco_Iran component… but it is near to absent in the steppe.
Very simple. Modern European Steppe folks (like Russians) have NOTHING to do with the ancient Iranic Central Asian Steppe folks. Only the ancient Indo-Iranized Steppes folks were full of Gedrosia. While modern Eastern Europeans don’t have that admixture, sicne Eastern Europeans have nothing in common with the ancient Indo-Iranized Steppes folks. The only common thing between ancient Indo-Iranized tribes and modern day Eastern Europeans is the Steppes admixture.
Those ancient Indo-Iranized Steppes folks are now Turkified and speak Turkic language as their native language and do consider themselves as Turks/Tatars.
With other words. Eastern Europeans (Balto-Slavs) are NOT directly related to Indo-Iranized cultures in the Steppes. And those ancient Indo-Iranized folks of the Steppes are now native Turkic/Tatar people of Kazakhstan, Uzbekistan, Turkmenistan, Kyrgyzstan.
Those Shintashta/Androno Steppes folks who were once Indo-IRANIZED by people (Aryans) from the Iranian Plateau were later Turkified and those Indo-Iranized Steppe cultures became Tatars/Turks.
Kristiina20-10-16, 14:53
Proto-Uralic is dated ~ 2000 BCE Jaakko Häkkinen who has given the most recent dating for different protolanguage levels based on linguistic criteria does not propose that Proto-Uralic is dated 2000 BCE.
In his model pre-Proto-Uralic and Proto-Uralic is dated between 3500 and 2800. The late Proto-Uralic is dated 2300 BC. However, the early history is quite blurred and the time margins are wide, but, by 2000 BC, Proto-Uralic had probably already disintegrated.
PolubieniePolubienie
http://bmcbiol.biomedcentral.com/articles/10.1186/1741-7007-8-15
Evidence that a West-East admixed population lived in the Tarim Basin as early as the early Bronze Age
Chunxiang Li, Hongjie Li, Yinqiu Cui, Chengzhi Xie, Dawei Cai, Wenying Li, Victor H Mair, Zhi Xu, Quanchao Zhang, Idelisi Abuduresule, Li Jin, Hong Zhu and Hui ZhouEmail author
BMC Biology20108:15
DOI: 10.1186/1741-7007-8-15
© Li et al; licensee BioMed Central Ltd. 2010
Received: 21 September 2009
Accepted: 17 February 2010
Published: 17 February 2010
Abstract
Background
The Tarim Basin, located on the ancient Silk Road, played a very important role in the history of human migration and cultural communications between the West and the East. However, both the exact period at which the relevant events occurred and the origins of the people in the area remain very obscure. In this paper, we present data from the analyses of both Y chromosomal and mitochondrial DNA (mtDNA) derived from human remains excavated from the Xiaohe cemetery, the oldest archeological site with human remains discovered in the Tarim Basin thus far.
Results
Mitochondrial DNA analysis showed that the Xiaohe people carried both the East Eurasian haplogroup (C) and the West Eurasian haplogroups (H and K), whereas Y chromosomal DNA analysis revealed only the West Eurasian haplogroup R1a1a in the male individuals.
Conclusion
Our results demonstrated that the Xiaohe people were an admixture from populations originating from both the West and the East, implying that the Tarim Basin had been occupied by an admixed population since the early Bronze Age. To our knowledge, this is the earliest genetic evidence of an admixed population settled in the Tarim Basin. (…)
Sample
MtDNA-HVRI
MtDNA
Y chromosome
Sexing
Independent
No.
haplotype
haplogroup
haplogroup
Morphological
Molecular
repetition
100
298-327
C4
Female
Female
√
102
298-327
C4
Female
–
106
298-327
C4
R1a1a
Male
Male
107
223-298-309-327
C4
Female
–
109
298-327
C4
Female
–
110
298-327
C4
Female
–
111
223-298-309-327
C4
R1a1a
Male
Male
115
298-327
C4
R1a1a
Male
Male
117
223-304
M*
Female
Female
119
93-134-224-311-390
K
Female
Female
√
120
189-192-311
R*
R1a1a
Male
Male
121
183-189-192-311
R*
R1a1a
Male
Male
127
223-298-309-327
C4
Female
Female
√
128
260
H
Female
Female
131
189-192-311-390
R*
Female
Female
132
298-327
C4
Female
Female
135
223-298-309-327
C4
Female
Female
136
298-327
C4
R1a1a
Male
Male
138
298-327
C4
–
Female
–
139
298-327
C4
R1a1a
Male
Male
PolubieniePolubienie
Karelczyk jest jakiś taki paleo syberyjski. I ci z Khvalynska, Comb Ware, Dniepr Donieck też wyglądają jak on. A R1a z Corded Ware jest inne. Gdzieś i jakoś podłapało domieszkę rolnika i drugą kaukaską, przez niektórych zwaną irańską. Masz jakiś pomysł jak to się stało? Chodzi mi o ten kaukaskoirański element. Własne żony zastąpili „Żonami z Armenii/Iranu” a te z kolei „żonami z Anatolii”?
Sławomir mógłby mi odpowiedzieć, ze to właśnie owo posuwanie się „Prasłowian” na zachód z Yamna. No wiesz, panie do CWC a panowie do BBC. Ale takie rozdzielenie populacji trudno zaakceptować. I również „praslawizacje” facetów R1a przez Armenki. No i jest jeszcze problem, bo tę kaukaską domieszkę miały i inne populacje wschodniej Europy. Nie tylko Yamowcy.
PolubieniePolubienie
„Karelczyk jest jakiś taki paleo syberyjski. I ci z Khvalynska, Comb Ware, Dniepr Donieck też wyglądają jak on. A R1a z Corded Ware jest inne. Gdzieś i jakoś podłapało domieszkę rolnika i drugą kaukaską, przez niektórych zwaną irańską. Masz jakiś pomysł jak to się stało? Chodzi mi o ten kaukaskoirański element. Własne żony zastąpili „Żonami z Armenii/Iranu” a te z kolei „żonami z Anatolii”?”
No właśnie… Dobrze kombinujesz. Odpowiedz mi proszę na to pytanie:
Skąd i kiedy wziął się Karelczyk, tam gdzie go znaleziono, hm?
Umiesz go wytłumaczyć jako kolesia, co przyszedł tam, „południową drogą R1a”? Spróbujesz? A no i proszę wykorzystaj do udowodnienia go DANE TYLKO Z TYCH TRZECH WPISÓW, KTÓRE RZEKOMO UDOWADNIAJĄ TO!! 😉
Właśnie rozsiadłem się wygodnie i mam w ręku piwko i prażoną kukurydzę… Oczekuję tu rubasznej rozrywki…
PolubieniePolubienie
OK. smacznego i na zdrowie. Tylko od piwa rośnie brzuch. I to nieestetycznie wygląda. Przerzuć się na coś innego.
„Skąd i kiedy wziął się Karelczyk, tam gdzie go znaleziono, hm?”
Już pisałam sto razy, ze był łowcą mamutów. I jako taki znajdował się w swojej strefie od Francji po Syberię. Rocznie pokonywał setki km. Pół roku spędzał na polowaniu i pół odpoczywał (albo i nie) gdzieś w górnym biegu rzeki. Był trochę podobny do SHG ze Skandynawii. Ale miał matkę ze wschodu. Ponadto miał „białe” geny.
On nie przyszedł z południa. W sensie Iranu czy Anatolii. Nie ma u niego żadnej wskazówki o tym świadczącej. Raczej bym była skłonna zastanowić się nad ewentualnością jego przybycia do pn. Europy z zachodu. Jeśli wschód by mi nie pasował. Ale nie z południa.
Co chcesz jeszcze wiedzieć?
PolubieniePolubienie
Piwko i kukurydza wirtualne. 🙂 Komentarz bardzo dobry, ale daję Ci tylko 50%,.. bo nie użyłaś podanych źródeł, na co liczyłem… Byłoby więcej, gdybyś oparła się na nich, ale daję Ci jeszcze jedna szansę, bo wspomniałaś to:
„On nie przyszedł z południa. W sensie Iranu czy Anatolii. Nie ma u niego żadnej wskazówki o tym świadczącej. Raczej bym była skłonna zastanowić się nad ewentualnością jego przybycia do pn. Europy z zachodu. Jeśli wschód by mi nie pasował. Ale nie z południa.”
Rozumiesz już po co marnowałem czas na oglądanie tych wszystkich ruskich „dowodów” i pisanie tych trzech wpisów? 🙂
PolubieniePolubienie
„Rozumiesz już po co marnowałem czas na oglądanie tych wszystkich ruskich „dowodów” i pisanie tych trzech wpisów?”
No właśnie nie. Za dużo tego wszystkiego opublikowałeś i (jak dla mnie) zrobił się miszmasz. Nie za wiele przeczytałam. I sądzę że nie tylko ja. A mam tez i inne zajęcia.
PolubieniePolubienie
No cóż… Nie ukrywam, że trochę mnie zaskoczyłaś…
UMIESZ UDOWODNIĆ POŁUDNIOWĄ DROGĘ R1A, NA PODSTAWIE TYCH TRZECH WPISÓW I OPISANYCH TAM „DOWODÓW”, CZY NIE UMIESZ? TAK, CZY NIE?
https://skribh.wordpress.com/2017/03/26/445-skrbh-36-odpowiedz-lowcom-ruskich-trolli-czyli-dlaczego-twierdzenie-o-10-000-latach-bytnosci-r1a-na-balkanach-to-jak-dotad-niczym-nie-potwierdzona-tylko-czysta-fanta/
https://skribh.wordpress.com/2017/04/02/449-skrbh-38-odpowiedz-lowcom-ruskich-trolli-czyli-dlaczego-twierdzenie-o-10-000-latach-bytnosci-r1a-na-balkanach-to-jak-dotad-niczym-nie-potwierdzona-tylko-czysta-fanta/
https://skribh.wordpress.com/2017/04/06/453-skrbh-39-odpowiedz-lowcom-ruskich-trolli-czyli-dlaczego-twierdzenie-o-10-000-latach-bytnosci-r1a-na-balkanach-to-jak-dotad-niczym-nie-potwierdzona-tylko-czysta-fanta/
PolubieniePolubienie
No cóż,.. Rozumiem. To po to pisze to wszystko, żeby nie było możliwość napisania o mnie, że ja to czy tamto… To są dowody, że kolesie zwyczajnie pierniczą nie wiedząc za wiele i tyle samo rozumiejąc z tego co piszą…
Tak jakoś stało się, że ja żyję min. z pisania, ale raczej skarg i odwołań, stąd pewno ta moja taka trochę sadystyczna dokładność w odpowiadaniu i szybkość w czytaniu i rozumieniu różnych danych… Jestem raczej mocno psychopatyczny, jeśli chodzi o zarzucanie mi pisania nieprawdy… 🙂 Wtedy włącza mi się z automatu tryb „Zniszczyć krteka” (z bajki o kreciku)… i go niszczę z wielką radością… Słyszałem już o tym nie raz od różnych osób, więc pewno to prawda…
Naucz się szybkiego skanowania tekstu, a nie czytania go dokładnego, bo to bardzo pomaga…
PolubieniePolubienie
Właściwie to bym wolała, żebyś ty w paru zdaniach napisał co dokładnie cie olśniło i jakie wnioski z tego wysnułeś.
PolubieniePolubienie
Kurcze, pisze już o tym co najmniej od tego wpisu…
https://skribh.wordpress.com/2017/03/18/441-skrbh-33-nowe-zrodla-genetyczne-czyli-czy-to-smierc-teorii-o-10000-lat-bytnosci-r1a-w-anatolii-na-balkanach-puszcie-i-pochodzeniu-szlachty-polskiej-od-sarmatow-itp/
PolubieniePolubienie
Drogi Skribho, Przykro mi, jeśli cię rozczarowałam.
Nie chcę bronić południowców. To Kliosow narzucił kierunek widzenia. A że niektórzy ufają autorytetom, i taka wizja przeszłości neci, to o tym piszą. Co w tym dziwnego?
Ja osobiście też uważam cie za ruskiego trolla, bo już wielokrotnie pisałeś GorAl, BaJkAL itp. No oczywiście takiego trolla z pluszu, jakiego przywiozłam sobie z Norwegii. Z baaardzo długim nosem i 2 zębami.
A o R1a to kiedys pisaliśmy. I wygląda na to, że naprawdę u współczesnej populacji Iranu występują najbardziej podstawowe klady R1a. Spadły z drzewa? Hm? Ale (na co zwracałam uwagę) niewiele młodsze klady są w Skandynawii. No i jest Karelczyk. (nie z południa) Tylko widze go paleoeuroazjatycko. Jak może przodka (czy jakieś prapodłoże) dla IE i uralofińskich. Czyli właściwie Paleosłowianina.
Na teraz to 1. o co chodzi z odezwą Dragomiry? 2. Co wiesz o mtDNA „H”. 3. Czy wiesz coś o kopalniach w Serbii? (sprzęty z CWC miały źródło w Serbii?) 4. Kiedy i dlaczego ”step” uniezależnił się od serbskiego kopalnictwa?
Może cos wiesz o tym? No i czekam na obiecane Afanasjewo.
PolubieniePolubienie
(…) Nie chcę bronić południowców. To Kliosow narzucił kierunek widzenia. A że niektórzy ufają autorytetom, i taka wizja przeszłości neci, to o tym piszą. Co w tym dziwnego? (…)
Nikt nie chce i nie umie tego bronić… Większość ludzie jest mocna tylko w rzucaniu oszczerstwami w tych, co wskazują na ich braki logiki i dowodów, potwierdzających „południową drogę R1a”. Wystarczy porównać to, co upowszechnili sami „obrońcy” tego pomysłu, żeby stwierdzić, że to jest,.. hm… kabaret… To jest zwykłe objawienie, jakie miał np. GroSS, albo jakieś dzieci z Midzugorjie, itd. Ja lubię tylko mięsko, a pierdolenie o Szopenie pozostawiam nawiedzonym… I gonię takich stąd, jak natrętne muchy, bo tylko srają na portret Cysorza…
Ciągle czekam na jakiś zryw i próbę odparcia mojego „ataku”… ale… oni są najlepsi w przemilczeniu niewygodnych dla nich faktów… No nic…
A co do ałtorytetóf, czy innych profesóróf… No cóż,.. Ja wolę otwarte umysły, jak np. Twój, i pytania, które one są w stanie zadać. Im jestem starszy, tym dyplomy robią na mnie mniejsze wrażanie… Sorki wszystkie mondre Winetouy…
(…) Na teraz to 1. o co chodzi z odezwą Dragomiry?(…)
Została upowszechniona. Nikt nie ma już nic o tym do powiedzenia, nawet tu patrz np.:
https://zapomnianalechia.wordpress.com/2017/03/27/organizacja-spoleczna-slowian/comment-page-1/#comment-439
Nie mogę teraz napisać, co Dragomira napisała do mnie, ale zrobię to kiedy przyjdzie na to odpowiedni czas. Za kilka wpisów, jak wyjaśni się wszystko, co ma być wyjaśnione. Zwróciłaś uwagę, że po za ładnymi i okrągłymi słowami nikt o niczym rzeczywistym nie napisał? To tak, jak z „południową drogą R1a” i dowodami na nią… Dragomira zrobi, co zrobi i tyle. Ja pomogłem tyle ile mogłem i tyle na ile to kogoś obchodziło… Mam nadzieję, że może weźmie sobie do serca, co jej podrzuciłem…
(…) 2. Co wiesz o mtDNA „H”. (…)
Wiem, że wg „ruskiego dowodu”, który upowszechnił Białczyński H2 i H3 miały rzekomo być najliczniejsze w Europie, co jest bzdurą, patrz dowody z eupedii, które załączyłem tam…
(…) 3. Czy wiesz coś o kopalniach w Serbii? (sprzęty z CWC miały źródło w Serbii?) (…)
Przecież upowszechniłem już np. te dwa filmy o początkach górnictwa na Bałkanach, bo raczej w Bułgarii, patrz kultura Warna i wytop złota, itp. Krzemień pasiasty Sznurowcy mieli u siebie w Krzemionkach Opatowskich… Masz jakieś dane o wytopie metali w tzw. kulturze sznurowej? Ja o tym nie czytałem nic…
https://pl.wikipedia.org/wiki/Chalkolit
(…) 4. Kiedy i dlaczego ”step” uniezależnił się od serbskiego kopalnictwa? (…)
NIGDY!!! Zadam Ci takie pytanie:
Skąd Scytowie mieli złoto na te ich ozdoby, hm? Gdzie je rzekomo wytapiali i wykonywali, hm? Uważam, że jest to przykład na import przedmiotów, a nie na ich wytwarzanie, czyli argument o Toyotach w Polsce., jako dowodzie na pobyt Japończyków tu… hehehe
I jeszcze jedno… Tak mi to chodzi po głowie, że jakoś dziwnie sztuka scytyjska jest różna od np. wzornictwa Słowian, czy… Ariów… Widziałaś u Scytów np. swargi, albo „ręce Boga”, hm?
Zobaczysz, że Scytowie ze Słowianami nie mieli w sumie wiele wspólnego… Upowszechnię o tym wpis, ale najpierw pokarzę prawdę o wiarygodności Klysova i jego twierdzeń…
(…) No i czekam na obiecane Afanasjewo. (…)
Zbliża się, ale jeszcze muszę wyczyścić przedpole i pokazać, jak niewiarygodne są przesłanki na „południową drogę R1a”…
PolubieniePolubienie
„Ciągle czekam na jakiś zryw i próbę odparcia mojego „ataku”… ale… oni są najlepsi w przemilczeniu niewygodnych dla nich faktów… No nic…”
Cholera. Ja chcę Afanasjewo, a ty czekasz na zryw. Rzuciłeś przynętę tydzień temu a ja muszę czekać.
Jeśli Vinca kultura była prasłowiańska, a nie znaleziono w niej R1a, no to chyba jasne, ze albo zjeść jabłko albo je mieć. Co kto woli. Ale nie ma co komentować, hipoteza hipotezy i te rzeczy. Trzeba mieć wiecej danych. Nikt się nie zerwie. Wiec wrzucaj co masz.
MtDNA „H” musi mieć coś z genem kaukaskim, irańskim, czy armeńskim jak go również zwą. Te mobilne żony z Armenii. Nie mam czasu na szukanie.
PolubieniePolubienie
Tylko do Skribhy.
Proponuję zrobić przerwę w poszukiwaniach „karelczyka”. Nie zatańczyłbyś ze mną na balu?
(polka – the name may have been derived from the Czech polka meaning „Polish woman”
Karelian-Finnish Polka)
Podobało się? Ja ich uwielbiam.
Czy ten ze skrzypcami nie wygląda jak „Super ruski troll”?
PolubieniePolubienie
Zatańczyłbym, aczkolwiek jestem teraz od środy niespodziewanie w bardzo bojowym nastroju i raczej pod wpływem tej ruskiej muzyki zacisnąłbym zęby i dłoń na rękojeści szabli lub topora i od razu pognałbym przed siebie,.. ale tak żeby zajść przeciwnika od tyłu lub z boku i wyciąć go w pień lub wytłuc, jak wybija się wszy… Mam ostatnio zła dużo do zwalczania… ale radzę sobie…
Tam na tym fińskim filmie wg mnie wszyscy wyglądają jak ruskie trolle,.. i to z piechoty morskiej, no nie licząc kobiet, bo to ruskie agentki, jak ta poniżej… hahaha 🙂
Отава Ё – Что за песни (Otava Yo – what songs)
Tęsknię do czegoś takiego…
Отава Ё – Иванушка-рачек (Otava Yo – Ivan the crayfish)
… ale teraz muszę knuć jak nabijać na pale angielskich szmaciarzy…
PolubieniePolubienie
O a tu więcej ruskich agentek…
SILENZIUM The battle goes on (И вновь продолжается бой) [Official Video]
PolubieniePolubienie
Znam to z „ruską agentką”, jak i wszystkie dotychczasowe dokonania Отава Ё. Świetne. Zwłaszcza epilog z wiankiem.
Oni są z Leningradu.
A bal to Minskiy bal pravoslavnoy molodyozhy. Tak, że tańcuja Białorusy. Отава Ё. giercują. Popatrz kto gra na skrzypcach. Mój ulubieniec „Super ruski troll” z 2 youtubka. Nie podobny do p.B.?
Finów nie ma. Fińska, a ściślej fińsko – karelska jest tylko polka. Słowiańszczyzna.
Wydało się, ze rusofilką jestem ja.
P.S. Иванушка-рачек – niczym mnie nie zaskoczysz. Znam to wszystko. Do mycia okien wybieram jednak „Finnish polka”.
PolubieniePolubienie
Aha… myślałem, że to Finowie… hehehe… Mnie inne ruskie agentki zarzucają czasem różną muzyką, ale raczej bardziej taką ludową… Tak, żebym skrzywienie burżuazyjnego nie podłapał i rewolucyjną czujność zachował…
Laboratorium Pieśni – Sztoj pa moru (Што й па мору)
Laboratorium Pieśni – Zabilili sniżki (Да забіліли сніжки)
Laboratorium Pieśni – Rasti, rasti moj zeleni bore
… albo np. to:
Oj, Ružice Rumena
TRAG – Mesečina (Official Video)
PolubieniePolubienie
UWAGA!!! Być może R1b na terenie Polski może być powiązane z Sarmatami!!!
http://www.historycy.org/index.php?showtopic=42083&view=findpost&p=1639307
Domen 7/04/2017, 15:10
Co do R1b to np. mój subklad L617 jest stosunkowo częsty na Wyspach Brytyjskich i w Iberii, oraz w Polsce i na Litwie. Natomiast praktycznie wcale nie występuje on w Niemczech, we Francji, ani w Skandynawii. Zrobiłem mapę miejsc urodzenia najstarszych znanych przodków wszystkich nosicieli mojego subkladu jakich znalazłem.
Na temat specyficznie polskich subkladów R1b pisałem tutaj:
http://www.historycy.org/index.php?showtopic=144062&st=465&p=1600506&#entry1600506
Natomiast wschodnioeuropejski jest m.in. subklad R1b-Z2103>Y5587 „Eastern European Type”.
Jest też subklad łączony ostatnio z Sarmatami (ponieważ znaleziono go w kopalnym DNA Sarmatów).
Obecnie sarmacki subklad R1b występuje w Polsce (np. znam gościa z Górnego Śląska, rdzennego „lokalsa”, który jest nosicielem właśnie tego sarmackiego subkladu – niedawno opublikowano DNA Sarmatów z epoki żelaza w pracy Unterlander 2017 i jeden należał do tego subkladu R1b):
http://www.ancestraljourneys.org/ironagedna.shtml
R1b-Y21707 – http://i.imgur.com/0fc3h1L.png
Ten post był edytowany przez Domen: 7/04/2017, 16:03
PolubieniePolubienie
Pingback: 77 Adrian Leszczyski. GENETYCY NA TROPIE POCHODZENIA EUROPEJCZYKÓW, CZĘŚĆ 1 | SKRBH